Incidental Mutation 'R9616:Myof'
ID 724634
Institutional Source Beutler Lab
Gene Symbol Myof
Ensembl Gene ENSMUSG00000048612
Gene Name myoferlin
Synonyms E030042N20Rik, 2310051D19Rik, Fer1l3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9616 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 37887484-38032025 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37923263 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1330 (I1330T)
Ref Sequence ENSEMBL: ENSMUSP00000045036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000225159] [ENSMUST00000226068]
AlphaFold Q69ZN7
Predicted Effect possibly damaging
Transcript: ENSMUST00000041475
AA Change: I1330T

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612
AA Change: I1330T

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1425 1436 N/A INTRINSIC
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
Pfam:Ferlin_C 1939 2043 2.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172095
AA Change: I1330T

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612
AA Change: I1330T

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
transmembrane domain 2013 2035 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000225159
AA Change: I814T

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000226068
AA Change: I1343T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040M04Rik T A 1: 151,080,480 (GRCm39) D189E probably benign Het
Abca13 A T 11: 9,240,501 (GRCm39) H788L probably benign Het
Abcb1b A G 5: 8,862,779 (GRCm39) I154V probably benign Het
Acsm4 A G 7: 119,293,872 (GRCm39) N81S probably benign Het
Adamts5 G A 16: 85,659,674 (GRCm39) H873Y probably benign Het
Aox4 C T 1: 58,268,020 (GRCm39) T200I possibly damaging Het
Arhgap33 A G 7: 30,229,367 (GRCm39) V336A probably damaging Het
Brca1 C T 11: 101,416,683 (GRCm39) E484K probably damaging Het
Capn13 T A 17: 73,672,964 (GRCm39) D113V probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,228,053 (GRCm39) probably benign Het
Ceacam3 G A 7: 16,892,078 (GRCm39) E274K Het
Cfh A T 1: 140,030,254 (GRCm39) I891K probably damaging Het
Cgn A G 3: 94,670,332 (GRCm39) S1041P probably damaging Het
Cldn18 T C 9: 99,580,915 (GRCm39) D111G probably benign Het
Cnp G A 11: 100,467,261 (GRCm39) R68Q probably benign Het
Cntn4 T A 6: 106,674,525 (GRCm39) C1008* probably null Het
Cntnap5a T C 1: 116,029,323 (GRCm39) I259T probably benign Het
Cubn A G 2: 13,319,529 (GRCm39) I2897T probably benign Het
Cyp2c39 T A 19: 39,501,648 (GRCm39) L67Q probably damaging Het
Dclk1 G A 3: 55,387,854 (GRCm39) C100Y probably damaging Het
Ddc C T 11: 11,772,288 (GRCm39) W349* probably null Het
Dennd3 A G 15: 73,440,563 (GRCm39) E1198G probably benign Het
Dnah1 T C 14: 31,026,400 (GRCm39) D826G probably null Het
Dpp4 T C 2: 62,217,429 (GRCm39) Y56C probably damaging Het
Etv6 A G 6: 134,243,295 (GRCm39) D350G possibly damaging Het
Fat1 C A 8: 45,406,075 (GRCm39) P942Q probably damaging Het
Fbxl5 A G 5: 43,916,159 (GRCm39) F418L probably benign Het
Fbxo11 T A 17: 88,316,098 (GRCm39) H368L Het
Fhl2 G T 1: 43,167,546 (GRCm39) H182Q probably damaging Het
Gabpa T A 16: 84,649,461 (GRCm39) C223S probably damaging Het
Gigyf2 T C 1: 87,356,326 (GRCm39) I803T unknown Het
Greb1 A T 12: 16,790,038 (GRCm39) N3K probably damaging Het
Hmcn1 T G 1: 150,684,473 (GRCm39) S366R probably benign Het
Il17b A G 18: 61,825,363 (GRCm39) Q133R probably benign Het
Inha T A 1: 75,486,211 (GRCm39) S169T probably benign Het
Itsn1 G A 16: 91,650,055 (GRCm39) R243H probably benign Het
Kcnu1 G GA 8: 26,403,675 (GRCm39) probably null Het
Kdm1b A G 13: 47,234,030 (GRCm39) E788G probably damaging Het
Kdm2a A T 19: 4,370,308 (GRCm39) I1059N probably damaging Het
Klk1b9 G T 7: 43,628,795 (GRCm39) G100C probably benign Het
Knl1 T C 2: 118,899,994 (GRCm39) V565A probably benign Het
Knl1 A T 2: 118,907,425 (GRCm39) N1650Y probably damaging Het
Lpp T C 16: 24,580,719 (GRCm39) V270A probably benign Het
Lrrc15 A G 16: 30,092,517 (GRCm39) L274P probably damaging Het
Mertk C T 2: 128,643,255 (GRCm39) L885F probably benign Het
Mpst T A 15: 78,294,361 (GRCm39) L31* probably null Het
Ms4a10 T C 19: 10,944,440 (GRCm39) T115A possibly damaging Het
Ncam2 T C 16: 81,240,142 (GRCm39) I201T probably damaging Het
Nefh T A 11: 4,889,443 (GRCm39) K1059* probably null Het
Nek1 T C 8: 61,473,107 (GRCm39) Y168H probably damaging Het
Nek11 T A 9: 105,082,011 (GRCm39) T531S probably damaging Het
Nelfa G A 5: 34,059,127 (GRCm39) P243S possibly damaging Het
Niban1 T C 1: 151,512,193 (GRCm39) Y32H probably damaging Het
Notum G T 11: 120,550,974 (GRCm39) T64K Het
Or13c7d T A 4: 43,770,193 (GRCm39) K273* probably null Het
Or52b2 A C 7: 104,986,520 (GRCm39) Y134* probably null Het
Or9i16 A G 19: 13,864,861 (GRCm39) S238P probably damaging Het
Otof A G 5: 30,539,708 (GRCm39) I1035T possibly damaging Het
Otud3 A G 4: 138,624,925 (GRCm39) Y259H probably benign Het
Per1 G T 11: 68,993,554 (GRCm39) C368F probably damaging Het
Pitrm1 G T 13: 6,605,602 (GRCm39) R183L probably damaging Het
Prl3a1 C T 13: 27,459,118 (GRCm39) A119V Het
Pycard C T 7: 127,592,776 (GRCm39) G17E probably benign Het
Rnf13 A G 3: 57,740,430 (GRCm39) D249G possibly damaging Het
Sdhaf2 T C 19: 10,494,689 (GRCm39) Y33C probably damaging Het
Sdk2 A G 11: 113,691,061 (GRCm39) V1838A probably benign Het
Sgo2b C T 8: 64,380,274 (GRCm39) V853I probably benign Het
Slc1a4 T C 11: 20,282,403 (GRCm39) T24A probably benign Het
Slc8a1 T C 17: 81,955,407 (GRCm39) T544A probably benign Het
Sntg2 T C 12: 30,326,732 (GRCm39) N143S probably benign Het
Sphkap T C 1: 83,254,989 (GRCm39) E920G probably damaging Het
Srgap2 T A 1: 131,252,828 (GRCm39) H132L Het
Srgap3 A T 6: 112,748,524 (GRCm39) V376D probably damaging Het
Stxbp5l T C 16: 37,036,314 (GRCm39) K434E probably damaging Het
Tab2 A T 10: 7,795,005 (GRCm39) N492K possibly damaging Het
Tbc1d32 T C 10: 56,037,246 (GRCm39) Q666R possibly damaging Het
Tekt4 T C 17: 25,692,782 (GRCm39) probably null Het
Tnni3k G A 3: 154,667,724 (GRCm39) Q230* probably null Het
Trp53bp1 A C 2: 121,066,657 (GRCm39) S690A probably benign Het
Trpa1 C A 1: 14,989,077 (GRCm39) probably benign Het
Trpm1 T G 7: 63,858,132 (GRCm39) V324G probably damaging Het
Usp29 A G 7: 6,966,179 (GRCm39) E674G possibly damaging Het
Vmn2r59 T C 7: 41,661,299 (GRCm39) R839G probably damaging Het
Vmn2r6 A G 3: 64,445,724 (GRCm39) L667P probably damaging Het
Vmn2r91 T A 17: 18,356,305 (GRCm39) F657L possibly damaging Het
Vps13d A G 4: 144,824,701 (GRCm39) V2923A Het
Xylb T A 9: 119,201,022 (GRCm39) L220Q probably damaging Het
Zbtb10 C T 3: 9,316,473 (GRCm39) T95M probably benign Het
Zfp263 C T 16: 3,567,482 (GRCm39) P599L probably damaging Het
Zfp532 A G 18: 65,789,639 (GRCm39) E1026G probably benign Het
Zfp78 A G 7: 6,382,078 (GRCm39) N376S probably benign Het
Other mutations in Myof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Myof APN 19 37,949,382 (GRCm39) missense probably benign 0.16
IGL00764:Myof APN 19 37,963,371 (GRCm39) missense probably benign 0.04
IGL00801:Myof APN 19 37,974,521 (GRCm39) missense probably damaging 0.99
IGL01084:Myof APN 19 37,924,884 (GRCm39) missense probably damaging 1.00
IGL01368:Myof APN 19 37,924,905 (GRCm39) missense probably damaging 0.97
IGL01472:Myof APN 19 37,911,524 (GRCm39) missense probably benign
IGL01785:Myof APN 19 37,968,871 (GRCm39) nonsense probably null
IGL02205:Myof APN 19 37,913,083 (GRCm39) missense probably damaging 1.00
IGL02268:Myof APN 19 37,963,311 (GRCm39) missense possibly damaging 0.90
IGL02268:Myof APN 19 37,942,877 (GRCm39) missense possibly damaging 0.50
IGL02339:Myof APN 19 37,960,661 (GRCm39) missense possibly damaging 0.46
IGL02433:Myof APN 19 37,960,641 (GRCm39) missense probably benign 0.05
IGL02481:Myof APN 19 37,926,361 (GRCm39) nonsense probably null
IGL02536:Myof APN 19 37,938,103 (GRCm39) missense probably damaging 0.97
IGL02682:Myof APN 19 37,909,929 (GRCm39) missense probably benign 0.09
IGL02732:Myof APN 19 37,966,164 (GRCm39) missense possibly damaging 0.50
IGL02887:Myof APN 19 37,909,227 (GRCm39) critical splice acceptor site probably null
IGL03114:Myof APN 19 37,892,309 (GRCm39) missense probably damaging 1.00
IGL03137:Myof APN 19 37,963,337 (GRCm39) missense probably damaging 1.00
IGL03340:Myof APN 19 37,899,607 (GRCm39) missense probably damaging 1.00
PIT4791001:Myof UTSW 19 37,971,406 (GRCm39) critical splice donor site probably null
R0024:Myof UTSW 19 37,904,188 (GRCm39) missense probably damaging 0.98
R0140:Myof UTSW 19 37,940,004 (GRCm39) nonsense probably null
R0309:Myof UTSW 19 37,969,714 (GRCm39) missense probably benign 0.12
R0330:Myof UTSW 19 37,924,326 (GRCm39) missense probably damaging 1.00
R0345:Myof UTSW 19 38,012,793 (GRCm39) missense probably damaging 1.00
R0349:Myof UTSW 19 37,899,417 (GRCm39) missense probably damaging 0.99
R0463:Myof UTSW 19 37,904,952 (GRCm39) missense probably damaging 1.00
R0507:Myof UTSW 19 37,889,725 (GRCm39) missense possibly damaging 0.94
R0512:Myof UTSW 19 37,942,972 (GRCm39) missense possibly damaging 0.54
R0608:Myof UTSW 19 37,904,952 (GRCm39) missense probably damaging 1.00
R0723:Myof UTSW 19 37,969,708 (GRCm39) missense probably damaging 1.00
R1081:Myof UTSW 19 37,974,536 (GRCm39) missense probably damaging 0.99
R1196:Myof UTSW 19 37,899,408 (GRCm39) missense probably damaging 1.00
R1243:Myof UTSW 19 37,924,540 (GRCm39) missense probably damaging 1.00
R1371:Myof UTSW 19 37,892,116 (GRCm39) splice site probably benign
R1381:Myof UTSW 19 37,983,933 (GRCm39) missense probably damaging 1.00
R1419:Myof UTSW 19 37,890,359 (GRCm39) missense probably damaging 1.00
R1527:Myof UTSW 19 37,913,067 (GRCm39) missense probably damaging 1.00
R1672:Myof UTSW 19 37,931,927 (GRCm39) missense probably damaging 1.00
R1864:Myof UTSW 19 37,975,153 (GRCm39) missense probably benign
R1914:Myof UTSW 19 37,966,141 (GRCm39) missense probably damaging 1.00
R1915:Myof UTSW 19 37,966,141 (GRCm39) missense probably damaging 1.00
R1970:Myof UTSW 19 37,934,082 (GRCm39) missense probably damaging 0.99
R2062:Myof UTSW 19 37,904,194 (GRCm39) missense possibly damaging 0.94
R2144:Myof UTSW 19 37,969,669 (GRCm39) critical splice donor site probably null
R2243:Myof UTSW 19 37,889,767 (GRCm39) missense probably damaging 1.00
R2339:Myof UTSW 19 37,926,375 (GRCm39) missense probably damaging 1.00
R2484:Myof UTSW 19 37,892,291 (GRCm39) missense probably benign 0.13
R2880:Myof UTSW 19 37,911,473 (GRCm39) missense probably benign 0.04
R3418:Myof UTSW 19 37,911,426 (GRCm39) missense probably damaging 0.97
R3967:Myof UTSW 19 38,011,058 (GRCm39) missense possibly damaging 0.59
R3967:Myof UTSW 19 37,889,711 (GRCm39) missense probably damaging 1.00
R3970:Myof UTSW 19 38,011,058 (GRCm39) missense possibly damaging 0.59
R3970:Myof UTSW 19 37,889,711 (GRCm39) missense probably damaging 1.00
R4238:Myof UTSW 19 37,911,456 (GRCm39) nonsense probably null
R4405:Myof UTSW 19 37,911,426 (GRCm39) missense probably damaging 0.97
R4406:Myof UTSW 19 37,911,426 (GRCm39) missense probably damaging 0.97
R4407:Myof UTSW 19 37,911,426 (GRCm39) missense probably damaging 0.97
R4408:Myof UTSW 19 37,911,426 (GRCm39) missense probably damaging 0.97
R4561:Myof UTSW 19 37,911,438 (GRCm39) missense probably benign
R4606:Myof UTSW 19 37,955,547 (GRCm39) missense probably damaging 1.00
R4778:Myof UTSW 19 37,938,011 (GRCm39) missense probably damaging 1.00
R4801:Myof UTSW 19 37,934,186 (GRCm39) missense probably benign 0.24
R4802:Myof UTSW 19 37,934,186 (GRCm39) missense probably benign 0.24
R4812:Myof UTSW 19 37,905,007 (GRCm39) missense probably damaging 1.00
R4884:Myof UTSW 19 37,930,805 (GRCm39) missense probably damaging 1.00
R4964:Myof UTSW 19 37,924,300 (GRCm39) missense probably damaging 0.97
R4966:Myof UTSW 19 37,924,300 (GRCm39) missense probably damaging 0.97
R5069:Myof UTSW 19 37,893,773 (GRCm39) missense possibly damaging 0.65
R5181:Myof UTSW 19 37,921,071 (GRCm39) missense possibly damaging 0.95
R5376:Myof UTSW 19 37,904,848 (GRCm39) missense probably damaging 1.00
R5384:Myof UTSW 19 37,941,435 (GRCm39) missense probably damaging 0.98
R5543:Myof UTSW 19 37,969,778 (GRCm39) missense probably benign 0.00
R5626:Myof UTSW 19 37,911,438 (GRCm39) missense probably benign
R5865:Myof UTSW 19 37,899,382 (GRCm39) missense probably damaging 1.00
R5919:Myof UTSW 19 38,012,818 (GRCm39) missense possibly damaging 0.95
R5924:Myof UTSW 19 37,971,421 (GRCm39) missense probably damaging 0.97
R5997:Myof UTSW 19 37,893,747 (GRCm39) missense possibly damaging 0.90
R5999:Myof UTSW 19 37,928,304 (GRCm39) nonsense probably null
R6039:Myof UTSW 19 37,966,132 (GRCm39) missense probably damaging 1.00
R6039:Myof UTSW 19 37,966,132 (GRCm39) missense probably damaging 1.00
R6041:Myof UTSW 19 37,913,068 (GRCm39) missense probably damaging 1.00
R6051:Myof UTSW 19 38,012,809 (GRCm39) missense probably damaging 1.00
R6057:Myof UTSW 19 37,915,429 (GRCm39) critical splice donor site probably null
R6089:Myof UTSW 19 37,955,508 (GRCm39) missense probably benign 0.37
R6195:Myof UTSW 19 37,901,805 (GRCm39) missense possibly damaging 0.89
R6478:Myof UTSW 19 37,892,279 (GRCm39) missense probably damaging 1.00
R6545:Myof UTSW 19 37,930,745 (GRCm39) missense possibly damaging 0.67
R6655:Myof UTSW 19 37,923,239 (GRCm39) missense probably damaging 1.00
R6715:Myof UTSW 19 37,956,794 (GRCm39) missense probably benign 0.04
R6737:Myof UTSW 19 37,931,962 (GRCm39) missense probably benign 0.01
R6837:Myof UTSW 19 37,911,404 (GRCm39) critical splice donor site probably null
R7096:Myof UTSW 19 37,924,648 (GRCm39) missense probably damaging 1.00
R7308:Myof UTSW 19 37,899,359 (GRCm39) missense probably damaging 0.98
R7328:Myof UTSW 19 37,904,847 (GRCm39) missense probably damaging 1.00
R7485:Myof UTSW 19 37,939,939 (GRCm39) nonsense probably null
R7554:Myof UTSW 19 37,942,958 (GRCm39) missense probably benign 0.09
R7759:Myof UTSW 19 37,928,346 (GRCm39) missense probably benign 0.00
R7779:Myof UTSW 19 37,927,838 (GRCm39) missense probably damaging 1.00
R8116:Myof UTSW 19 37,921,167 (GRCm39) missense probably damaging 0.99
R8264:Myof UTSW 19 37,909,881 (GRCm39) missense probably damaging 1.00
R8415:Myof UTSW 19 37,983,872 (GRCm39) missense probably benign
R8756:Myof UTSW 19 37,928,400 (GRCm39) missense probably benign
R8777:Myof UTSW 19 37,968,841 (GRCm39) missense probably benign 0.01
R8777-TAIL:Myof UTSW 19 37,968,841 (GRCm39) missense probably benign 0.01
R8835:Myof UTSW 19 37,955,547 (GRCm39) missense possibly damaging 0.92
R9046:Myof UTSW 19 37,923,112 (GRCm39) intron probably benign
R9396:Myof UTSW 19 37,923,294 (GRCm39) missense probably damaging 1.00
R9415:Myof UTSW 19 37,941,412 (GRCm39) missense probably damaging 1.00
R9450:Myof UTSW 19 37,949,374 (GRCm39) missense probably damaging 1.00
R9451:Myof UTSW 19 37,966,096 (GRCm39) critical splice donor site probably null
R9537:Myof UTSW 19 37,896,054 (GRCm39) missense probably damaging 1.00
R9592:Myof UTSW 19 38,031,737 (GRCm39) missense probably damaging 0.99
R9751:Myof UTSW 19 37,924,818 (GRCm39) missense probably benign
X0024:Myof UTSW 19 37,963,045 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGGGGCCATTTGGAGCTTTC -3'
(R):5'- TCGCTCCATCTTAAAGACTGTACTG -3'

Sequencing Primer
(F):5'- GCCATTTGGAGCTTTCAGTAAC -3'
(R):5'- CCATCTTAAAGACTGTACTGTGTTC -3'
Posted On 2022-09-12