Incidental Mutation 'R9616:Myof'
ID 724634
Institutional Source Beutler Lab
Gene Symbol Myof
Ensembl Gene ENSMUSG00000048612
Gene Name myoferlin
Synonyms Fer1l3, E030042N20Rik, 2310051D19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9616 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 37899036-38043577 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37934815 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1330 (I1330T)
Ref Sequence ENSEMBL: ENSMUSP00000045036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000225159] [ENSMUST00000226068]
AlphaFold Q69ZN7
Predicted Effect possibly damaging
Transcript: ENSMUST00000041475
AA Change: I1330T

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612
AA Change: I1330T

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1425 1436 N/A INTRINSIC
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
Pfam:Ferlin_C 1939 2043 2.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172095
AA Change: I1330T

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612
AA Change: I1330T

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
transmembrane domain 2013 2035 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000225159
AA Change: I814T

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000226068
AA Change: I1343T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040M04Rik T A 1: 151,204,729 D189E probably benign Het
Abca13 A T 11: 9,290,501 H788L probably benign Het
Abcb1b A G 5: 8,812,779 I154V probably benign Het
Acsm4 A G 7: 119,694,649 N81S probably benign Het
Adamts5 G A 16: 85,862,786 H873Y probably benign Het
Aox4 C T 1: 58,228,861 T200I possibly damaging Het
Arhgap33 A G 7: 30,529,942 V336A probably damaging Het
Brca1 C T 11: 101,525,857 E484K probably damaging Het
Capn13 T A 17: 73,365,969 D113V probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ceacam3 G A 7: 17,158,153 E274K Het
Cfh A T 1: 140,102,516 I891K probably damaging Het
Cgn A G 3: 94,763,025 S1041P probably damaging Het
Cldn18 T C 9: 99,698,862 D111G probably benign Het
Cnp G A 11: 100,576,435 R68Q probably benign Het
Cntn4 T A 6: 106,697,564 C1008* probably null Het
Cntnap5a T C 1: 116,101,593 I259T probably benign Het
Cubn A G 2: 13,314,718 I2897T probably benign Het
Cyp2c39 T A 19: 39,513,204 L67Q probably damaging Het
Dclk1 G A 3: 55,480,433 C100Y probably damaging Het
Ddc C T 11: 11,822,288 W349* probably null Het
Dennd3 A G 15: 73,568,714 E1198G probably benign Het
Dnah1 T C 14: 31,304,443 D826G probably null Het
Dpp4 T C 2: 62,387,085 Y56C probably damaging Het
Etv6 A G 6: 134,266,332 D350G possibly damaging Het
Fam129a T C 1: 151,636,442 Y32H probably damaging Het
Fat1 C A 8: 44,953,038 P942Q probably damaging Het
Fbxl5 A G 5: 43,758,817 F418L probably benign Het
Fbxo11 T A 17: 88,008,670 H368L Het
Fhl2 G T 1: 43,128,386 H182Q probably damaging Het
Gabpa T A 16: 84,852,573 C223S probably damaging Het
Gigyf2 T C 1: 87,428,604 I803T unknown Het
Greb1 A T 12: 16,740,037 N3K probably damaging Het
Hmcn1 T G 1: 150,808,722 S366R probably benign Het
Il17b A G 18: 61,692,292 Q133R probably benign Het
Inha T A 1: 75,509,567 S169T probably benign Het
Itsn1 G A 16: 91,853,167 R243H probably benign Het
Kcnu1 G GA 8: 25,913,647 probably null Het
Kdm1b A G 13: 47,080,554 E788G probably damaging Het
Kdm2a A T 19: 4,320,280 I1059N probably damaging Het
Klk1b9 G T 7: 43,979,371 G100C probably benign Het
Knl1 T C 2: 119,069,513 V565A probably benign Het
Knl1 A T 2: 119,076,944 N1650Y probably damaging Het
Lpp T C 16: 24,761,969 V270A probably benign Het
Lrrc15 A G 16: 30,273,699 L274P probably damaging Het
Mertk C T 2: 128,801,335 L885F probably benign Het
Mpst T A 15: 78,410,161 L31* probably null Het
Ms4a10 T C 19: 10,967,076 T115A possibly damaging Het
Ncam2 T C 16: 81,443,254 I201T probably damaging Het
Nefh T A 11: 4,939,443 K1059* probably null Het
Nek1 T C 8: 61,020,073 Y168H probably damaging Het
Nek11 T A 9: 105,204,812 T531S probably damaging Het
Nelfa G A 5: 33,901,783 P243S possibly damaging Het
Notum G T 11: 120,660,148 T64K Het
Olfr1504 A G 19: 13,887,497 S238P probably damaging Het
Olfr159 T A 4: 43,770,193 K273* probably null Het
Olfr691 A C 7: 105,337,313 Y134* probably null Het
Otof A G 5: 30,382,364 I1035T possibly damaging Het
Otud3 A G 4: 138,897,614 Y259H probably benign Het
Per1 G T 11: 69,102,728 C368F probably damaging Het
Pitrm1 G T 13: 6,555,566 R183L probably damaging Het
Prl3a1 C T 13: 27,275,135 A119V Het
Pycard C T 7: 127,993,604 G17E probably benign Het
Rnf13 A G 3: 57,833,009 D249G possibly damaging Het
Sdhaf2 T C 19: 10,517,325 Y33C probably damaging Het
Sdk2 A G 11: 113,800,235 V1838A probably benign Het
Sgo2b C T 8: 63,927,240 V853I probably benign Het
Slc1a4 T C 11: 20,332,403 T24A probably benign Het
Slc8a1 T C 17: 81,647,978 T544A probably benign Het
Sntg2 T C 12: 30,276,733 N143S probably benign Het
Sphkap T C 1: 83,277,268 E920G probably damaging Het
Srgap2 T A 1: 131,325,090 H132L Het
Srgap3 A T 6: 112,771,563 V376D probably damaging Het
Stxbp5l T C 16: 37,215,952 K434E probably damaging Het
Tab2 A T 10: 7,919,241 N492K possibly damaging Het
Tbc1d32 T C 10: 56,161,150 Q666R possibly damaging Het
Tekt4 T C 17: 25,473,808 probably null Het
Tnni3k G A 3: 154,962,087 Q230* probably null Het
Trp53bp1 A C 2: 121,236,176 S690A probably benign Het
Trpa1 C A 1: 14,918,853 probably benign Het
Trpm1 T G 7: 64,208,384 V324G probably damaging Het
Usp29 A G 7: 6,963,180 E674G possibly damaging Het
Vmn2r59 T C 7: 42,011,875 R839G probably damaging Het
Vmn2r6 A G 3: 64,538,303 L667P probably damaging Het
Vmn2r91 T A 17: 18,136,043 F657L possibly damaging Het
Vps13d A G 4: 145,098,131 V2923A Het
Xylb T A 9: 119,371,956 L220Q probably damaging Het
Zbtb10 C T 3: 9,251,413 T95M probably benign Het
Zfp263 C T 16: 3,749,618 P599L probably damaging Het
Zfp532 A G 18: 65,656,568 E1026G probably benign Het
Zfp78 A G 7: 6,379,079 N376S probably benign Het
Other mutations in Myof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Myof APN 19 37960934 missense probably benign 0.16
IGL00764:Myof APN 19 37974923 missense probably benign 0.04
IGL00801:Myof APN 19 37986073 missense probably damaging 0.99
IGL01084:Myof APN 19 37936436 missense probably damaging 1.00
IGL01368:Myof APN 19 37936457 missense probably damaging 0.97
IGL01472:Myof APN 19 37923076 missense probably benign
IGL01785:Myof APN 19 37980423 nonsense probably null
IGL02205:Myof APN 19 37924635 missense probably damaging 1.00
IGL02268:Myof APN 19 37954429 missense possibly damaging 0.50
IGL02268:Myof APN 19 37974863 missense possibly damaging 0.90
IGL02339:Myof APN 19 37972213 missense possibly damaging 0.46
IGL02433:Myof APN 19 37972193 missense probably benign 0.05
IGL02481:Myof APN 19 37937913 nonsense probably null
IGL02536:Myof APN 19 37949655 missense probably damaging 0.97
IGL02682:Myof APN 19 37921481 missense probably benign 0.09
IGL02732:Myof APN 19 37977716 missense possibly damaging 0.50
IGL02887:Myof APN 19 37920779 critical splice acceptor site probably null
IGL03114:Myof APN 19 37903861 missense probably damaging 1.00
IGL03137:Myof APN 19 37974889 missense probably damaging 1.00
IGL03340:Myof APN 19 37911159 missense probably damaging 1.00
PIT4791001:Myof UTSW 19 37982958 critical splice donor site probably null
R0024:Myof UTSW 19 37915740 missense probably damaging 0.98
R0140:Myof UTSW 19 37951556 nonsense probably null
R0309:Myof UTSW 19 37981266 missense probably benign 0.12
R0330:Myof UTSW 19 37935878 missense probably damaging 1.00
R0345:Myof UTSW 19 38024345 missense probably damaging 1.00
R0349:Myof UTSW 19 37910969 missense probably damaging 0.99
R0463:Myof UTSW 19 37916504 missense probably damaging 1.00
R0507:Myof UTSW 19 37901277 missense possibly damaging 0.94
R0512:Myof UTSW 19 37954524 missense possibly damaging 0.54
R0608:Myof UTSW 19 37916504 missense probably damaging 1.00
R0723:Myof UTSW 19 37981260 missense probably damaging 1.00
R1081:Myof UTSW 19 37986088 missense probably damaging 0.99
R1196:Myof UTSW 19 37910960 missense probably damaging 1.00
R1243:Myof UTSW 19 37936092 missense probably damaging 1.00
R1371:Myof UTSW 19 37903668 splice site probably benign
R1381:Myof UTSW 19 37995485 missense probably damaging 1.00
R1419:Myof UTSW 19 37901911 missense probably damaging 1.00
R1527:Myof UTSW 19 37924619 missense probably damaging 1.00
R1672:Myof UTSW 19 37943479 missense probably damaging 1.00
R1864:Myof UTSW 19 37986705 missense probably benign
R1914:Myof UTSW 19 37977693 missense probably damaging 1.00
R1915:Myof UTSW 19 37977693 missense probably damaging 1.00
R1970:Myof UTSW 19 37945634 missense probably damaging 0.99
R2062:Myof UTSW 19 37915746 missense possibly damaging 0.94
R2144:Myof UTSW 19 37981221 critical splice donor site probably null
R2243:Myof UTSW 19 37901319 missense probably damaging 1.00
R2339:Myof UTSW 19 37937927 missense probably damaging 1.00
R2484:Myof UTSW 19 37903843 missense probably benign 0.13
R2880:Myof UTSW 19 37923025 missense probably benign 0.04
R3418:Myof UTSW 19 37922978 missense probably damaging 0.97
R3967:Myof UTSW 19 37901263 missense probably damaging 1.00
R3967:Myof UTSW 19 38022610 missense possibly damaging 0.59
R3970:Myof UTSW 19 37901263 missense probably damaging 1.00
R3970:Myof UTSW 19 38022610 missense possibly damaging 0.59
R4238:Myof UTSW 19 37923008 nonsense probably null
R4405:Myof UTSW 19 37922978 missense probably damaging 0.97
R4406:Myof UTSW 19 37922978 missense probably damaging 0.97
R4407:Myof UTSW 19 37922978 missense probably damaging 0.97
R4408:Myof UTSW 19 37922978 missense probably damaging 0.97
R4561:Myof UTSW 19 37922990 missense probably benign
R4606:Myof UTSW 19 37967099 missense probably damaging 1.00
R4778:Myof UTSW 19 37949563 missense probably damaging 1.00
R4801:Myof UTSW 19 37945738 missense probably benign 0.24
R4802:Myof UTSW 19 37945738 missense probably benign 0.24
R4812:Myof UTSW 19 37916559 missense probably damaging 1.00
R4884:Myof UTSW 19 37942357 missense probably damaging 1.00
R4964:Myof UTSW 19 37935852 missense probably damaging 0.97
R4966:Myof UTSW 19 37935852 missense probably damaging 0.97
R5069:Myof UTSW 19 37905325 missense possibly damaging 0.65
R5181:Myof UTSW 19 37932623 missense possibly damaging 0.95
R5376:Myof UTSW 19 37916400 missense probably damaging 1.00
R5384:Myof UTSW 19 37952987 missense probably damaging 0.98
R5543:Myof UTSW 19 37981330 missense probably benign 0.00
R5626:Myof UTSW 19 37922990 missense probably benign
R5865:Myof UTSW 19 37910934 missense probably damaging 1.00
R5919:Myof UTSW 19 38024370 missense possibly damaging 0.95
R5924:Myof UTSW 19 37982973 missense probably damaging 0.97
R5997:Myof UTSW 19 37905299 missense possibly damaging 0.90
R5999:Myof UTSW 19 37939856 nonsense probably null
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6041:Myof UTSW 19 37924620 missense probably damaging 1.00
R6051:Myof UTSW 19 38024361 missense probably damaging 1.00
R6057:Myof UTSW 19 37926981 critical splice donor site probably null
R6089:Myof UTSW 19 37967060 missense probably benign 0.37
R6195:Myof UTSW 19 37913357 missense possibly damaging 0.89
R6478:Myof UTSW 19 37903831 missense probably damaging 1.00
R6545:Myof UTSW 19 37942297 missense possibly damaging 0.67
R6655:Myof UTSW 19 37934791 missense probably damaging 1.00
R6715:Myof UTSW 19 37968346 missense probably benign 0.04
R6737:Myof UTSW 19 37943514 missense probably benign 0.01
R6837:Myof UTSW 19 37922956 critical splice donor site probably null
R7096:Myof UTSW 19 37936200 missense probably damaging 1.00
R7308:Myof UTSW 19 37910911 missense probably damaging 0.98
R7328:Myof UTSW 19 37916399 missense probably damaging 1.00
R7485:Myof UTSW 19 37951491 nonsense probably null
R7554:Myof UTSW 19 37954510 missense probably benign 0.09
R7759:Myof UTSW 19 37939898 missense probably benign 0.00
R7779:Myof UTSW 19 37939390 missense probably damaging 1.00
R8116:Myof UTSW 19 37932719 missense probably damaging 0.99
R8264:Myof UTSW 19 37921433 missense probably damaging 1.00
R8415:Myof UTSW 19 37995424 missense probably benign
R8756:Myof UTSW 19 37939952 missense probably benign
R8777:Myof UTSW 19 37980393 missense probably benign 0.01
R8777-TAIL:Myof UTSW 19 37980393 missense probably benign 0.01
R8835:Myof UTSW 19 37967099 missense possibly damaging 0.92
R9396:Myof UTSW 19 37934846 missense probably damaging 1.00
R9415:Myof UTSW 19 37952964 missense probably damaging 1.00
R9450:Myof UTSW 19 37960926 missense probably damaging 1.00
R9451:Myof UTSW 19 37977648 critical splice donor site probably null
R9537:Myof UTSW 19 37907606 missense probably damaging 1.00
R9592:Myof UTSW 19 38043289 missense probably damaging 0.99
R9751:Myof UTSW 19 37936370 missense probably benign
X0024:Myof UTSW 19 37974597 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGGGGCCATTTGGAGCTTTC -3'
(R):5'- TCGCTCCATCTTAAAGACTGTACTG -3'

Sequencing Primer
(F):5'- GCCATTTGGAGCTTTCAGTAAC -3'
(R):5'- CCATCTTAAAGACTGTACTGTGTTC -3'
Posted On 2022-09-12