Incidental Mutation 'R9618:Vmn1r228'
ID 724683
Institutional Source Beutler Lab
Gene Symbol Vmn1r228
Ensembl Gene ENSMUSG00000060245
Gene Name vomeronasal 1 receptor 228
Synonyms V1re3
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9618 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 20996321-20997763 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20997045 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 158 (M158V)
Ref Sequence ENSEMBL: ENSMUSP00000072243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072410]
AlphaFold Q8R2A7
Predicted Effect probably benign
Transcript: ENSMUST00000072410
AA Change: M158V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072243
Gene: ENSMUSG00000060245
AA Change: M158V

DomainStartEndE-ValueType
Pfam:TAS2R 32 317 2.6e-11 PFAM
Pfam:7tm_1 53 316 2.6e-9 PFAM
Pfam:V1R 63 321 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik C T 3: 68,777,402 (GRCm39) P121L probably damaging Het
2310002L09Rik C A 4: 73,868,934 (GRCm39) M1I probably null Het
2510039O18Rik T A 4: 148,029,873 (GRCm39) Y614* probably null Het
4930562C15Rik A T 16: 4,667,418 (GRCm39) S270C unknown Het
Ak9 A C 10: 41,203,627 (GRCm39) T173P Het
Cfc1 T C 1: 34,575,560 (GRCm39) L78P probably benign Het
Chrd T G 16: 20,552,378 (GRCm39) C82W probably damaging Het
Cln6 T C 9: 62,758,111 (GRCm39) V290A probably damaging Het
Cps1 A G 1: 67,196,975 (GRCm39) D342G possibly damaging Het
Cracd A G 5: 77,004,617 (GRCm39) D326G unknown Het
Cryzl2 G A 1: 157,289,578 (GRCm39) R72H probably benign Het
Cyp2j6 A T 4: 96,414,085 (GRCm39) H393Q probably benign Het
Eefsec T C 6: 88,274,681 (GRCm39) T428A probably benign Het
Ergic1 G A 17: 26,827,619 (GRCm39) G25S probably damaging Het
Esf1 T C 2: 140,001,714 (GRCm39) I378V probably benign Het
Fndc1 T A 17: 7,990,313 (GRCm39) T1128S unknown Het
Gabrp A T 11: 33,504,342 (GRCm39) Y324* probably null Het
Hadha G A 5: 30,339,165 (GRCm39) T270M possibly damaging Het
Hdac1-ps T C 17: 78,799,114 (GRCm39) I35T probably damaging Het
Ino80d G A 1: 63,101,342 (GRCm39) T428M probably damaging Het
Itgae T C 11: 73,011,171 (GRCm39) F647S possibly damaging Het
Kank4 T C 4: 98,653,732 (GRCm39) R899G possibly damaging Het
Kcna4 T A 2: 107,126,374 (GRCm39) N369K probably benign Het
Kcnip3 G T 2: 127,352,812 (GRCm39) P69Q probably benign Het
Mcf2l A G 8: 13,034,320 (GRCm39) probably benign Het
Mtmr2 T C 9: 13,707,315 (GRCm39) V289A probably benign Het
Muc21 GGGGTGGGCATAGATCCTGAGGCAGAGCTGGATGCAGTGGTGGTCAGGGTGGG GGGGTGGG 17: 35,932,935 (GRCm39) probably benign Het
Nxph1 T G 6: 9,247,108 (GRCm39) N26K probably benign Het
Obox1 A G 7: 15,289,624 (GRCm39) I138V possibly damaging Het
Or4c35 A T 2: 89,808,343 (GRCm39) T74S probably benign Het
Or4m1 A T 14: 50,557,760 (GRCm39) Y177* probably null Het
Or7e176 G A 9: 20,171,639 (GRCm39) V168M possibly damaging Het
P2ry14 T A 3: 59,023,251 (GRCm39) M70L probably damaging Het
Pcare T A 17: 72,057,817 (GRCm39) Y620F probably damaging Het
Pcnt A G 10: 76,188,794 (GRCm39) Y2869H probably damaging Het
Pkd1l1 T C 11: 8,911,420 (GRCm39) R286G Het
Pygb C T 2: 150,657,008 (GRCm39) R320W Het
Rsf1 G GACGGCGGCC 7: 97,229,116 (GRCm39) probably benign Het
Slc15a5 A T 6: 138,032,779 (GRCm39) S192T possibly damaging Het
Tex15 A G 8: 34,062,397 (GRCm39) H609R probably benign Het
Tmem256 T A 11: 69,730,210 (GRCm39) S73T possibly damaging Het
Tpr G T 1: 150,321,979 (GRCm39) A2338S possibly damaging Het
Trub2 A T 2: 29,673,346 (GRCm39) M119K probably benign Het
Vmn2r100 A T 17: 19,742,583 (GRCm39) H319L probably damaging Het
Vmn2r3 T A 3: 64,178,724 (GRCm39) I514F probably damaging Het
Wnt16 T A 6: 22,297,891 (GRCm39) Y252* probably null Het
Wnt16 G T 6: 22,297,892 (GRCm39) E253* probably null Het
Xkr4 A T 1: 3,741,201 (GRCm39) V124E probably damaging Het
Zc3h13 G T 14: 75,567,542 (GRCm39) R945L Het
Zfp445 T C 9: 122,685,788 (GRCm39) N251D probably damaging Het
Zfp683 A T 4: 133,782,965 (GRCm39) D143V probably benign Het
Other mutations in Vmn1r228
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Vmn1r228 APN 17 20,996,774 (GRCm39) missense probably benign 0.07
IGL03275:Vmn1r228 APN 17 20,997,104 (GRCm39) missense probably damaging 1.00
PIT4498001:Vmn1r228 UTSW 17 20,996,772 (GRCm39) missense probably benign 0.00
R0097:Vmn1r228 UTSW 17 20,996,625 (GRCm39) missense probably benign 0.05
R0097:Vmn1r228 UTSW 17 20,996,625 (GRCm39) missense probably benign 0.05
R0270:Vmn1r228 UTSW 17 20,996,858 (GRCm39) missense possibly damaging 0.60
R0279:Vmn1r228 UTSW 17 20,996,637 (GRCm39) missense probably benign 0.02
R1544:Vmn1r228 UTSW 17 20,997,285 (GRCm39) missense probably benign 0.00
R1695:Vmn1r228 UTSW 17 20,996,560 (GRCm39) missense possibly damaging 0.49
R2086:Vmn1r228 UTSW 17 20,997,455 (GRCm39) missense possibly damaging 0.71
R2275:Vmn1r228 UTSW 17 20,996,807 (GRCm39) missense probably damaging 1.00
R2965:Vmn1r228 UTSW 17 20,996,609 (GRCm39) missense probably damaging 0.99
R4425:Vmn1r228 UTSW 17 20,996,861 (GRCm39) missense probably damaging 1.00
R4447:Vmn1r228 UTSW 17 20,997,369 (GRCm39) missense probably damaging 0.96
R5031:Vmn1r228 UTSW 17 20,996,943 (GRCm39) nonsense probably null
R6345:Vmn1r228 UTSW 17 20,997,144 (GRCm39) missense probably damaging 1.00
R7064:Vmn1r228 UTSW 17 20,997,285 (GRCm39) missense probably benign 0.00
R7880:Vmn1r228 UTSW 17 20,996,672 (GRCm39) missense probably damaging 1.00
R8000:Vmn1r228 UTSW 17 20,997,227 (GRCm39) missense possibly damaging 0.88
R8290:Vmn1r228 UTSW 17 20,996,724 (GRCm39) missense probably benign 0.09
R9022:Vmn1r228 UTSW 17 20,996,778 (GRCm39) missense probably damaging 1.00
R9027:Vmn1r228 UTSW 17 20,997,422 (GRCm39) missense probably benign 0.01
R9291:Vmn1r228 UTSW 17 20,997,023 (GRCm39) missense probably benign
R9492:Vmn1r228 UTSW 17 20,996,862 (GRCm39) missense probably damaging 1.00
X0018:Vmn1r228 UTSW 17 20,996,963 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCATGAAGGTGCTGGAAACTAC -3'
(R):5'- GGAGCTTTTGGGTCAAAGCAG -3'

Sequencing Primer
(F):5'- TAAGACTTCCGGAAACACGC -3'
(R):5'- AGCTTTTGGGTCAAAGCAGTTATTC -3'
Posted On 2022-09-12