Incidental Mutation 'R9620:Ilkap'
ID 724690
Institutional Source Beutler Lab
Gene Symbol Ilkap
Ensembl Gene ENSMUSG00000026309
Gene Name integrin-linked kinase-associated serine/threonine phosphatase 2C
Synonyms 1600009O09Rik, 0710007A14Rik, PP2C-DELTA
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.221) question?
Stock # R9620 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 91373861-91398815 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 91376251 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 163 (C163R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027534] [ENSMUST00000086861] [ENSMUST00000187306] [ENSMUST00000187678] [ENSMUST00000190747]
AlphaFold Q8R0F6
Predicted Effect probably benign
Transcript: ENSMUST00000027534
SMART Domains Protein: ENSMUSP00000027534
Gene: ENSMUSG00000026309

DomainStartEndE-ValueType
Blast:PP2C_SIG 26 64 4e-12 BLAST
PP2Cc 94 388 4.47e-93 SMART
PP2C_SIG 128 390 9.82e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086861
SMART Domains Protein: ENSMUSP00000084073
Gene: ENSMUSG00000047443

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 40 58 N/A INTRINSIC
low complexity region 85 113 N/A INTRINSIC
low complexity region 170 180 N/A INTRINSIC
Blast:TNF 200 337 3e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000187049
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000187306
SMART Domains Protein: ENSMUSP00000139834
Gene: ENSMUSG00000026309

DomainStartEndE-ValueType
Blast:PP2Cc 7 73 2e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000187678
Predicted Effect probably benign
Transcript: ENSMUST00000190747
SMART Domains Protein: ENSMUSP00000140905
Gene: ENSMUSG00000026309

DomainStartEndE-ValueType
PP2Cc 1 164 7.3e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190998
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protein serine/threonine phosphatase of the PP2C family. This protein can interact with integrin-linked kinase (ILK/ILK1), a regulator of integrin mediated signaling, and regulate the kinase activity of ILK. Through the interaction with ILK, this protein may selectively affect the signaling process of ILK-mediated glycogen synthase kinase 3 beta (GSK3beta), and thus participate in Wnt signaling pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null gene trap insertion exhibit enhanced motor coordination, and male homozygous mice exhibit increased cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik A G 9: 36,637,202 probably null Het
Abhd3 G T 18: 10,704,605 T151K possibly damaging Het
Acsf2 C T 11: 94,572,586 W130* probably null Het
Aldh16a1 G A 7: 45,147,989 R132* probably null Het
Amer3 C T 1: 34,588,962 P761S probably benign Het
Amotl1 G T 9: 14,548,673 D886E probably damaging Het
Cacna1s T C 1: 136,108,171 F1383S probably damaging Het
Casc4 T C 2: 121,906,761 V261A probably benign Het
Col14a1 T A 15: 55,362,385 V148E unknown Het
Col9a2 T A 4: 121,053,206 probably null Het
Cyp2a5 T A 7: 26,837,211 M205K possibly damaging Het
Dcst2 A T 3: 89,370,518 Q466L possibly damaging Het
Ecel1 T C 1: 87,153,131 I350V possibly damaging Het
Enthd1 G A 15: 80,452,700 T511I probably benign Het
Exoc6b T A 6: 85,011,320 K92* probably null Het
Fam181a T G 12: 103,316,332 Y165* probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam71d A C 12: 78,715,303 D247A probably damaging Het
Fbxo34 A G 14: 47,531,268 Y746C probably damaging Het
Fgfr4 T A 13: 55,161,181 S372T possibly damaging Het
Fmo1 A G 1: 162,833,821 F298L probably benign Het
Gad1 A C 2: 70,574,276 D170A possibly damaging Het
Golgb1 T C 16: 36,919,449 S2758P probably benign Het
H2afv A T 11: 6,429,094 probably null Het
Krt9 A T 11: 100,188,360 D735E unknown Het
Lipo3 A T 19: 33,582,229 C80* probably null Het
Lpcat3 C T 6: 124,703,580 P478L probably damaging Het
Luc7l3 G A 11: 94,321,719 R24C unknown Het
Mafa T A 15: 75,747,312 H204L probably benign Het
Mapk10 A C 5: 102,966,607 V305G probably damaging Het
Mgat1 T C 11: 49,261,295 F202L probably benign Het
Micalcl A T 7: 112,381,196 T126S probably benign Het
Mill1 G A 7: 18,263,102 R206H probably benign Het
Nlrc5 A T 8: 94,476,406 Y378F probably benign Het
Nlrp9a G T 7: 26,551,044 R78L probably damaging Het
Olfr1358 G T 10: 78,520,294 A229S probably benign Het
Olfr150 A T 9: 39,736,991 M59L Het
Olfr556 A T 7: 102,670,804 I295F possibly damaging Het
Orc6 A T 8: 85,299,801 probably benign Het
Pcdhgb5 C T 18: 37,731,433 Q94* probably null Het
Pcnx A G 12: 81,950,186 D952G probably damaging Het
Ppfia2 A T 10: 106,913,658 H1135L Het
Prmt2 A T 10: 76,225,379 I91N probably damaging Het
Ptprm A G 17: 66,809,489 Y932H probably damaging Het
Qrich2 T C 11: 116,447,120 K154R probably damaging Het
Rapgef4 A G 2: 72,205,707 T515A probably benign Het
Rgmb G A 17: 15,821,017 R103* probably null Het
Ripk1 T G 13: 34,026,823 S334A possibly damaging Het
Rnf5 C T 17: 34,601,747 G147S possibly damaging Het
Ryr1 T C 7: 29,015,713 Y4662C unknown Het
Secisbp2l A G 2: 125,747,474 M718T probably damaging Het
Slc16a6 T C 11: 109,463,496 T100A probably benign Het
Slc27a6 T A 18: 58,609,815 M525K probably damaging Het
Slco2a1 G C 9: 103,084,866 C579S probably damaging Het
Snx14 A G 9: 88,381,741 S864P probably damaging Het
Sptbn2 T C 19: 4,750,507 L2250P probably damaging Het
Tlr6 A T 5: 64,954,803 S254T possibly damaging Het
Trap1 A T 16: 4,040,219 Y675* probably null Het
Ttc9b C A 7: 27,654,087 A54E probably damaging Het
Unc45a A C 7: 80,325,655 Y934D probably damaging Het
Usp17ld A G 7: 103,250,972 L251P possibly damaging Het
Usp42 A G 5: 143,717,399 V489A probably damaging Het
Vars A G 17: 35,016,025 T1277A unknown Het
Vmn2r117 A G 17: 23,478,476 S81P probably damaging Het
Vmn2r69 T A 7: 85,412,296 I157F probably benign Het
Zfp697 A G 3: 98,427,866 S316G probably damaging Het
Zfp729b T A 13: 67,591,668 H826L probably damaging Het
Other mutations in Ilkap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Ilkap APN 1 91385238 critical splice donor site probably null
PIT4445001:Ilkap UTSW 1 91385345 missense probably benign
R0184:Ilkap UTSW 1 91376305 unclassified probably benign
R0782:Ilkap UTSW 1 91378550 missense probably damaging 1.00
R1366:Ilkap UTSW 1 91387215 missense possibly damaging 0.58
R1552:Ilkap UTSW 1 91384594 missense probably damaging 1.00
R2155:Ilkap UTSW 1 91384623 missense possibly damaging 0.65
R3946:Ilkap UTSW 1 91387250 missense probably damaging 1.00
R4005:Ilkap UTSW 1 91385263 missense probably benign 0.03
R4860:Ilkap UTSW 1 91387383 unclassified probably benign
R5666:Ilkap UTSW 1 91391141 missense probably benign 0.38
R5670:Ilkap UTSW 1 91391141 missense probably benign 0.38
R7324:Ilkap UTSW 1 91385393 splice site probably null
R8493:Ilkap UTSW 1 91378544 missense probably damaging 1.00
R8548:Ilkap UTSW 1 91391160 missense possibly damaging 0.81
R9227:Ilkap UTSW 1 91387215 missense probably benign 0.41
R9230:Ilkap UTSW 1 91387215 missense probably benign 0.41
R9694:Ilkap UTSW 1 91376251 missense
Predicted Primers PCR Primer
(F):5'- TCAACAGCAGGCTTCCCTTC -3'
(R):5'- GGTCACCTTTGTTCAGGAGC -3'

Sequencing Primer
(F):5'- GGATCTTGTCATCCTACCAAAGGG -3'
(R):5'- CTTGTGGCTGAGACCCTTG -3'
Posted On 2022-09-12