Incidental Mutation 'R0762:Cdhr3'
ID72470
Institutional Source Beutler Lab
Gene Symbol Cdhr3
Ensembl Gene ENSMUSG00000035860
Gene Namecadherin-related family member 3
Synonyms1110049B09Rik
MMRRC Submission 038942-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0762 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location33033796-33092875 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 33060301 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 328 (R328L)
Ref Sequence ENSEMBL: ENSMUSP00000093449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095774]
Predicted Effect probably benign
Transcript: ENSMUST00000095774
AA Change: R328L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000093449
Gene: ENSMUSG00000035860
AA Change: R328L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CA 36 131 5.54e-2 SMART
CA 156 234 3.73e-10 SMART
CA 258 343 5.47e-17 SMART
CA 369 459 9.87e-1 SMART
CA 483 564 1.17e-16 SMART
CA 590 683 1.1e0 SMART
transmembrane domain 708 730 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219065
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219453
Meta Mutation Damage Score 0.1354 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 93.9%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,218,416 probably benign Het
4921504E06Rik T A 2: 19,477,856 N475I probably damaging Het
Adar T C 3: 89,739,983 probably benign Het
Aldh3b3 A T 19: 3,965,747 probably null Het
Amtn C T 5: 88,385,000 T158I possibly damaging Het
Ap1g2 A G 14: 55,100,411 probably benign Het
Arhgef3 A G 14: 27,397,627 Y318C probably damaging Het
Atg2b A C 12: 105,674,970 V69G possibly damaging Het
Bbx G A 16: 50,225,166 T236I possibly damaging Het
Bcl11b C T 12: 107,965,663 probably benign Het
Catsperg1 T C 7: 29,189,952 I794V probably benign Het
Ccdc88a C T 11: 29,463,112 probably benign Het
Ces2e T A 8: 104,929,864 M242K probably damaging Het
Col12a1 A G 9: 79,681,374 probably benign Het
Col3a1 T C 1: 45,321,526 S39P unknown Het
Cyp2a5 T A 7: 26,838,873 Y220* probably null Het
D3Ertd254e G A 3: 36,165,867 D680N possibly damaging Het
Dcc T A 18: 71,342,705 probably benign Het
Dnajb8 A G 6: 88,223,054 T191A probably damaging Het
Ephx2 A T 14: 66,102,179 F199I probably damaging Het
Fancd2 A G 6: 113,574,658 K1062E probably benign Het
Fbxo33 A G 12: 59,204,499 V410A probably benign Het
Gars T G 6: 55,077,580 probably null Het
Git1 A C 11: 77,499,834 D132A possibly damaging Het
Gm853 A G 4: 130,221,624 S44P probably damaging Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Gucy1a1 T C 3: 82,094,896 T44A unknown Het
Hjurp G C 1: 88,277,215 probably benign Het
Ifnlr1 A G 4: 135,701,329 K156E possibly damaging Het
Klf13 T C 7: 63,891,623 N15S probably benign Het
Krt77 T C 15: 101,861,126 probably null Het
Map4 C A 9: 110,038,478 probably benign Het
Mthfr T C 4: 148,055,443 I623T possibly damaging Het
Myo7b T A 18: 31,983,944 T908S probably benign Het
Nbeal2 T G 9: 110,643,808 probably benign Het
Nwd2 T G 5: 63,800,414 F362L probably benign Het
Pcm1 A T 8: 41,261,020 R208W probably damaging Het
Pkd2l1 T C 19: 44,150,470 D647G probably benign Het
Plbd1 C T 6: 136,641,147 V24M probably damaging Het
Polr2a G A 11: 69,735,117 P1698S unknown Het
Prss12 T C 3: 123,485,504 I410T probably damaging Het
Ptpre A G 7: 135,679,235 N565S probably damaging Het
Rab44 T C 17: 29,145,270 L606P unknown Het
Rbm10 C T X: 20,637,664 probably benign Het
Rhd C T 4: 134,876,301 probably benign Het
Rspo3 T A 10: 29,499,921 probably benign Het
Sdccag8 T A 1: 176,946,144 N555K probably benign Het
Skint6 T A 4: 112,865,651 probably benign Het
Slc22a20 G A 19: 5,986,008 P45S probably damaging Het
Slc5a2 A G 7: 128,267,482 Y124C probably damaging Het
Spats2l T C 1: 57,885,884 L127P possibly damaging Het
Taar8a T A 10: 24,077,077 I193N probably benign Het
Ten1 C T 11: 116,216,684 probably benign Het
Tfb2m T C 1: 179,545,833 E100G probably damaging Het
Tom1 C T 8: 75,052,306 probably benign Het
Vps52 G T 17: 33,960,011 R171L probably damaging Het
Zcwpw2 A T 9: 118,014,114 noncoding transcript Het
Zfhx4 G A 3: 5,403,820 E3013K probably damaging Het
Zfp777 C T 6: 48,029,360 V411M probably damaging Het
Other mutations in Cdhr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Cdhr3 APN 12 33052209 missense probably benign 0.00
IGL01508:Cdhr3 APN 12 33053428 missense possibly damaging 0.84
IGL02396:Cdhr3 APN 12 33045196 missense possibly damaging 0.64
IGL02414:Cdhr3 APN 12 33042504 missense possibly damaging 0.76
IGL02450:Cdhr3 APN 12 33082225 missense probably benign
IGL02453:Cdhr3 APN 12 33042503 missense probably damaging 0.97
IGL02567:Cdhr3 APN 12 33038901 missense probably benign 0.02
IGL03342:Cdhr3 APN 12 33051055 missense probably benign 0.14
R0022:Cdhr3 UTSW 12 33082264 missense probably damaging 1.00
R0022:Cdhr3 UTSW 12 33082264 missense probably damaging 1.00
R0133:Cdhr3 UTSW 12 33092752 missense possibly damaging 0.94
R0140:Cdhr3 UTSW 12 33080413 missense probably benign 0.00
R0157:Cdhr3 UTSW 12 33061650 missense possibly damaging 0.52
R1421:Cdhr3 UTSW 12 33060292 missense probably damaging 1.00
R1553:Cdhr3 UTSW 12 33042371 missense probably benign 0.10
R1691:Cdhr3 UTSW 12 33082247 missense probably damaging 0.99
R1822:Cdhr3 UTSW 12 33045205 missense probably null 1.00
R1855:Cdhr3 UTSW 12 33060352 missense probably damaging 1.00
R1897:Cdhr3 UTSW 12 33045193 missense possibly damaging 0.81
R2496:Cdhr3 UTSW 12 33049069 missense probably benign 0.01
R2507:Cdhr3 UTSW 12 33038915 missense probably benign
R3155:Cdhr3 UTSW 12 33049153 missense possibly damaging 0.83
R3906:Cdhr3 UTSW 12 33053428 missense probably damaging 0.97
R4005:Cdhr3 UTSW 12 33080356 missense probably damaging 0.98
R4277:Cdhr3 UTSW 12 33060233 missense probably null 0.16
R4573:Cdhr3 UTSW 12 33068153 splice site probably null
R4752:Cdhr3 UTSW 12 33086103 missense probably damaging 0.99
R5364:Cdhr3 UTSW 12 33051008 missense possibly damaging 0.67
R5562:Cdhr3 UTSW 12 33051055 missense probably benign 0.01
R5564:Cdhr3 UTSW 12 33048986 nonsense probably null
R5768:Cdhr3 UTSW 12 33046686 missense possibly damaging 0.73
R6255:Cdhr3 UTSW 12 33053475 missense probably damaging 1.00
R6821:Cdhr3 UTSW 12 33035045 missense probably damaging 1.00
R6983:Cdhr3 UTSW 12 33042380 missense probably benign 0.32
R7155:Cdhr3 UTSW 12 33061773 missense probably damaging 1.00
R7496:Cdhr3 UTSW 12 33060265 missense probably damaging 1.00
R7736:Cdhr3 UTSW 12 33053520 missense probably benign 0.33
R7788:Cdhr3 UTSW 12 33060320 missense probably damaging 1.00
RF023:Cdhr3 UTSW 12 33060349 missense probably damaging 1.00
X0024:Cdhr3 UTSW 12 33067236 missense possibly damaging 0.90
X0028:Cdhr3 UTSW 12 33042456 missense probably benign
Z1176:Cdhr3 UTSW 12 33060322 missense probably damaging 1.00
Z1176:Cdhr3 UTSW 12 33080324 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGTAGAGAGTCAGTCCCCAATGCC -3'
(R):5'- CAGTTCTGTCAGCAGTGGACAGTG -3'

Sequencing Primer
(F):5'- TGCCATGCCTTATCAGAGAATC -3'
(R):5'- GGTGCAAGCTGATCATCATTC -3'
Posted On2013-09-30