Incidental Mutation 'R9620:Lpcat3'
ID 724705
Institutional Source Beutler Lab
Gene Symbol Lpcat3
Ensembl Gene ENSMUSG00000004270
Gene Name lysophosphatidylcholine acyltransferase 3
Synonyms Mboat5, Grcc3f, Oact5
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.192) question?
Stock # R9620 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 124663027-124704418 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 124703580 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 478 (P478L)
Ref Sequence ENSEMBL: ENSMUSP00000004381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004379] [ENSMUST00000004381] [ENSMUST00000128721] [ENSMUST00000203238]
AlphaFold Q91V01
Predicted Effect probably benign
Transcript: ENSMUST00000004379
SMART Domains Protein: ENSMUSP00000004379
Gene: ENSMUSG00000004268

DomainStartEndE-ValueType
Pfam:EMG1 45 238 2.9e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000004381
AA Change: P478L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000004381
Gene: ENSMUSG00000004270
AA Change: P478L

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
Pfam:MBOAT 126 437 1.2e-81 PFAM
transmembrane domain 454 473 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128721
SMART Domains Protein: ENSMUSP00000144738
Gene: ENSMUSG00000004270

DomainStartEndE-ValueType
transmembrane domain 41 63 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203238
SMART Domains Protein: ENSMUSP00000144730
Gene: ENSMUSG00000004268

DomainStartEndE-ValueType
Pfam:EMG1 55 122 1e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Nullizygous mice show low blood glucose levels and postnatal death. Intestine-specific knockouts fail to thrive and show enterocyte lipid accumulation and low plasma triglycerides (TGs). Liver-specific knockouts show low plasma TGs, fatty liver, and secrete VLDL lacking arachidonoyl phospholipids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik A G 9: 36,637,202 probably null Het
Abhd3 G T 18: 10,704,605 T151K possibly damaging Het
Acsf2 C T 11: 94,572,586 W130* probably null Het
Aldh16a1 G A 7: 45,147,989 R132* probably null Het
Amer3 C T 1: 34,588,962 P761S probably benign Het
Amotl1 G T 9: 14,548,673 D886E probably damaging Het
Cacna1s T C 1: 136,108,171 F1383S probably damaging Het
Casc4 T C 2: 121,906,761 V261A probably benign Het
Col14a1 T A 15: 55,362,385 V148E unknown Het
Col9a2 T A 4: 121,053,206 probably null Het
Cyp2a5 T A 7: 26,837,211 M205K possibly damaging Het
Dcst2 A T 3: 89,370,518 Q466L possibly damaging Het
Ecel1 T C 1: 87,153,131 I350V possibly damaging Het
Enthd1 G A 15: 80,452,700 T511I probably benign Het
Exoc6b T A 6: 85,011,320 K92* probably null Het
Fam181a T G 12: 103,316,332 Y165* probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam71d A C 12: 78,715,303 D247A probably damaging Het
Fbxo34 A G 14: 47,531,268 Y746C probably damaging Het
Fgfr4 T A 13: 55,161,181 S372T possibly damaging Het
Fmo1 A G 1: 162,833,821 F298L probably benign Het
Gad1 A C 2: 70,574,276 D170A possibly damaging Het
Golgb1 T C 16: 36,919,449 S2758P probably benign Het
H2afv A T 11: 6,429,094 probably null Het
Ilkap A G 1: 91,376,251 C163R Het
Krt9 A T 11: 100,188,360 D735E unknown Het
Lipo3 A T 19: 33,582,229 C80* probably null Het
Luc7l3 G A 11: 94,321,719 R24C unknown Het
Mafa T A 15: 75,747,312 H204L probably benign Het
Mapk10 A C 5: 102,966,607 V305G probably damaging Het
Mgat1 T C 11: 49,261,295 F202L probably benign Het
Micalcl A T 7: 112,381,196 T126S probably benign Het
Mill1 G A 7: 18,263,102 R206H probably benign Het
Nlrc5 A T 8: 94,476,406 Y378F probably benign Het
Nlrp9a G T 7: 26,551,044 R78L probably damaging Het
Olfr1358 G T 10: 78,520,294 A229S probably benign Het
Olfr150 A T 9: 39,736,991 M59L Het
Olfr556 A T 7: 102,670,804 I295F possibly damaging Het
Orc6 A T 8: 85,299,801 probably benign Het
Pcdhgb5 C T 18: 37,731,433 Q94* probably null Het
Pcnx A G 12: 81,950,186 D952G probably damaging Het
Ppfia2 A T 10: 106,913,658 H1135L Het
Prmt2 A T 10: 76,225,379 I91N probably damaging Het
Ptprm A G 17: 66,809,489 Y932H probably damaging Het
Qrich2 T C 11: 116,447,120 K154R probably damaging Het
Rapgef4 A G 2: 72,205,707 T515A probably benign Het
Rgmb G A 17: 15,821,017 R103* probably null Het
Ripk1 T G 13: 34,026,823 S334A possibly damaging Het
Rnf5 C T 17: 34,601,747 G147S possibly damaging Het
Ryr1 T C 7: 29,015,713 Y4662C unknown Het
Secisbp2l A G 2: 125,747,474 M718T probably damaging Het
Slc16a6 T C 11: 109,463,496 T100A probably benign Het
Slc27a6 T A 18: 58,609,815 M525K probably damaging Het
Slco2a1 G C 9: 103,084,866 C579S probably damaging Het
Snx14 A G 9: 88,381,741 S864P probably damaging Het
Sptbn2 T C 19: 4,750,507 L2250P probably damaging Het
Tlr6 A T 5: 64,954,803 S254T possibly damaging Het
Trap1 A T 16: 4,040,219 Y675* probably null Het
Ttc9b C A 7: 27,654,087 A54E probably damaging Het
Unc45a A C 7: 80,325,655 Y934D probably damaging Het
Usp17ld A G 7: 103,250,972 L251P possibly damaging Het
Usp42 A G 5: 143,717,399 V489A probably damaging Het
Vars A G 17: 35,016,025 T1277A unknown Het
Vmn2r117 A G 17: 23,478,476 S81P probably damaging Het
Vmn2r69 T A 7: 85,412,296 I157F probably benign Het
Zfp697 A G 3: 98,427,866 S316G probably damaging Het
Zfp729b T A 13: 67,591,668 H826L probably damaging Het
Other mutations in Lpcat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Lpcat3 APN 6 124699338 missense possibly damaging 0.78
IGL02279:Lpcat3 APN 6 124698109 missense probably damaging 1.00
IGL02869:Lpcat3 APN 6 124703007 missense possibly damaging 0.65
R0045:Lpcat3 UTSW 6 124701474 missense probably benign 0.12
R0045:Lpcat3 UTSW 6 124701474 missense probably benign 0.12
R2075:Lpcat3 UTSW 6 124703103 missense probably damaging 1.00
R3757:Lpcat3 UTSW 6 124699992 splice site probably null
R4181:Lpcat3 UTSW 6 124703224 unclassified probably benign
R4583:Lpcat3 UTSW 6 124703323 missense possibly damaging 0.92
R5134:Lpcat3 UTSW 6 124702530 missense probably benign 0.00
R5159:Lpcat3 UTSW 6 124699394 intron probably benign
R6703:Lpcat3 UTSW 6 124663222 missense probably benign 0.02
R6833:Lpcat3 UTSW 6 124700011 missense probably damaging 1.00
R7261:Lpcat3 UTSW 6 124698087 missense probably benign 0.02
R7604:Lpcat3 UTSW 6 124702530 missense probably benign 0.00
R9399:Lpcat3 UTSW 6 124663320 missense probably benign 0.00
R9756:Lpcat3 UTSW 6 124703004 critical splice acceptor site probably null
X0017:Lpcat3 UTSW 6 124698118 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TTCATGGGTTACTCTATGACTGC -3'
(R):5'- CCTTCTAGCAAGGCAGAACC -3'

Sequencing Primer
(F):5'- ATGGGTTACTCTATGACTGCCTTCTG -3'
(R):5'- GGCAGAACCTACAGTGTCC -3'
Posted On 2022-09-12