Incidental Mutation 'R0762:Arhgef3'
ID72474
Institutional Source Beutler Lab
Gene Symbol Arhgef3
Ensembl Gene ENSMUSG00000021895
Gene NameRho guanine nucleotide exchange factor (GEF) 3
Synonyms9830169H03Rik, 1200004I24Rik, C76747
MMRRC Submission 038942-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R0762 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location27114899-27403911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27397627 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 318 (Y318C)
Ref Sequence ENSEMBL: ENSMUSP00000046486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049206] [ENSMUST00000224981] [ENSMUST00000225949]
Predicted Effect probably damaging
Transcript: ENSMUST00000049206
AA Change: Y318C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046486
Gene: ENSMUSG00000021895
AA Change: Y318C

DomainStartEndE-ValueType
RhoGEF 132 309 4.11e-51 SMART
PH 318 457 3.26e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224981
AA Change: Y311C

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000225949
AA Change: Y338C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.4348 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 93.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho-like GTPases are involved in a variety of cellular processes, and they are activated by binding GTP and inactivated by conversion of GTP to GDP by their intrinsic GTPase activity. Guanine nucleotide exchange factors (GEFs) accelerate the GTPase activity of Rho GTPases by catalyzing their release of bound GDP. This gene encodes a guanine nucleotide exchange factor, which specifically activates two members of the Rho GTPase family: RHOA and RHOB, both of which have a role in bone cell biology. It has been identified that genetic variation in this gene plays a role in the determination of bone mineral density (BMD), indicating the implication of this gene in postmenopausal osteoporosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased mean platelet volume and a mild delay in platelet recovery in response to thrombocytopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,218,416 probably benign Het
4921504E06Rik T A 2: 19,477,856 N475I probably damaging Het
Adar T C 3: 89,739,983 probably benign Het
Aldh3b3 A T 19: 3,965,747 probably null Het
Amtn C T 5: 88,385,000 T158I possibly damaging Het
Ap1g2 A G 14: 55,100,411 probably benign Het
Atg2b A C 12: 105,674,970 V69G possibly damaging Het
Bbx G A 16: 50,225,166 T236I possibly damaging Het
Bcl11b C T 12: 107,965,663 probably benign Het
Catsperg1 T C 7: 29,189,952 I794V probably benign Het
Ccdc88a C T 11: 29,463,112 probably benign Het
Cdhr3 C A 12: 33,060,301 R328L probably benign Het
Ces2e T A 8: 104,929,864 M242K probably damaging Het
Col12a1 A G 9: 79,681,374 probably benign Het
Col3a1 T C 1: 45,321,526 S39P unknown Het
Cyp2a5 T A 7: 26,838,873 Y220* probably null Het
D3Ertd254e G A 3: 36,165,867 D680N possibly damaging Het
Dcc T A 18: 71,342,705 probably benign Het
Dnajb8 A G 6: 88,223,054 T191A probably damaging Het
Ephx2 A T 14: 66,102,179 F199I probably damaging Het
Fancd2 A G 6: 113,574,658 K1062E probably benign Het
Fbxo33 A G 12: 59,204,499 V410A probably benign Het
Gars T G 6: 55,077,580 probably null Het
Git1 A C 11: 77,499,834 D132A possibly damaging Het
Gm853 A G 4: 130,221,624 S44P probably damaging Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Gucy1a1 T C 3: 82,094,896 T44A unknown Het
Hjurp G C 1: 88,277,215 probably benign Het
Ifnlr1 A G 4: 135,701,329 K156E possibly damaging Het
Klf13 T C 7: 63,891,623 N15S probably benign Het
Krt77 T C 15: 101,861,126 probably null Het
Map4 C A 9: 110,038,478 probably benign Het
Mthfr T C 4: 148,055,443 I623T possibly damaging Het
Myo7b T A 18: 31,983,944 T908S probably benign Het
Nbeal2 T G 9: 110,643,808 probably benign Het
Nwd2 T G 5: 63,800,414 F362L probably benign Het
Pcm1 A T 8: 41,261,020 R208W probably damaging Het
Pkd2l1 T C 19: 44,150,470 D647G probably benign Het
Plbd1 C T 6: 136,641,147 V24M probably damaging Het
Polr2a G A 11: 69,735,117 P1698S unknown Het
Prss12 T C 3: 123,485,504 I410T probably damaging Het
Ptpre A G 7: 135,679,235 N565S probably damaging Het
Rab44 T C 17: 29,145,270 L606P unknown Het
Rbm10 C T X: 20,637,664 probably benign Het
Rhd C T 4: 134,876,301 probably benign Het
Rspo3 T A 10: 29,499,921 probably benign Het
Sdccag8 T A 1: 176,946,144 N555K probably benign Het
Skint6 T A 4: 112,865,651 probably benign Het
Slc22a20 G A 19: 5,986,008 P45S probably damaging Het
Slc5a2 A G 7: 128,267,482 Y124C probably damaging Het
Spats2l T C 1: 57,885,884 L127P possibly damaging Het
Taar8a T A 10: 24,077,077 I193N probably benign Het
Ten1 C T 11: 116,216,684 probably benign Het
Tfb2m T C 1: 179,545,833 E100G probably damaging Het
Tom1 C T 8: 75,052,306 probably benign Het
Vps52 G T 17: 33,960,011 R171L probably damaging Het
Zcwpw2 A T 9: 118,014,114 noncoding transcript Het
Zfhx4 G A 3: 5,403,820 E3013K probably damaging Het
Zfp777 C T 6: 48,029,360 V411M probably damaging Het
Other mutations in Arhgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Arhgef3 APN 14 27401919 nonsense probably null
IGL02178:Arhgef3 APN 14 27265529 nonsense probably null
IGL02302:Arhgef3 APN 14 27362842 missense probably benign 0.08
IGL02505:Arhgef3 APN 14 27394000 missense possibly damaging 0.92
IGL03203:Arhgef3 APN 14 27394116 missense probably damaging 1.00
IGL03339:Arhgef3 APN 14 27401857 missense probably damaging 0.99
R1192:Arhgef3 UTSW 14 27379706 missense probably damaging 1.00
R1572:Arhgef3 UTSW 14 27401735 missense probably damaging 1.00
R1794:Arhgef3 UTSW 14 27397605 missense probably benign 0.44
R2426:Arhgef3 UTSW 14 27384181 nonsense probably null
R2509:Arhgef3 UTSW 14 27379676 missense probably damaging 1.00
R4932:Arhgef3 UTSW 14 27384213 missense probably damaging 0.99
R5017:Arhgef3 UTSW 14 27265530 missense possibly damaging 0.85
R5216:Arhgef3 UTSW 14 27401842 missense probably benign 0.00
R6562:Arhgef3 UTSW 14 27152996 start gained probably benign
R6951:Arhgef3 UTSW 14 27144018 start gained probably benign
R7140:Arhgef3 UTSW 14 27401707 missense probably damaging 1.00
R7361:Arhgef3 UTSW 14 27265578 missense possibly damaging 0.56
R8042:Arhgef3 UTSW 14 27362809 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTTGCAGTAGCCACATAGATCTCAGC -3'
(R):5'- TTTTCTGAAGTCCAAGTGGGACACAG -3'

Sequencing Primer
(F):5'- GTAGCCACATAGATCTCAGCTCTTG -3'
(R):5'- ggcaggaaggcaggcag -3'
Posted On2013-09-30