Incidental Mutation 'R9620:Golgb1'
ID 724745
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Name golgin B1
Synonyms C130074L01Rik, Gm6840, F730017E11Rik, Giantin, 6330407A06Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.918) question?
Stock # R9620 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 36695502-36753447 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36739811 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2758 (S2758P)
Ref Sequence ENSEMBL: ENSMUSP00000045239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039855] [ENSMUST00000114812]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039855
AA Change: S2758P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045239
Gene: ENSMUSG00000034243
AA Change: S2758P

DomainStartEndE-ValueType
internal_repeat_2 24 61 7.47e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
coiled coil region 130 219 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
internal_repeat_3 519 558 7.47e-6 PROSPERO
coiled coil region 563 594 N/A INTRINSIC
internal_repeat_4 627 661 3.38e-5 PROSPERO
coiled coil region 679 1121 N/A INTRINSIC
coiled coil region 1153 1240 N/A INTRINSIC
internal_repeat_4 1253 1288 3.38e-5 PROSPERO
low complexity region 1300 1314 N/A INTRINSIC
internal_repeat_1 1321 1352 3.51e-6 PROSPERO
low complexity region 1357 1369 N/A INTRINSIC
coiled coil region 1402 1755 N/A INTRINSIC
internal_repeat_2 1760 1798 7.47e-6 PROSPERO
internal_repeat_3 1761 1804 7.47e-6 PROSPERO
coiled coil region 1818 2034 N/A INTRINSIC
low complexity region 2291 2306 N/A INTRINSIC
internal_repeat_1 2351 2382 3.51e-6 PROSPERO
low complexity region 2400 2418 N/A INTRINSIC
low complexity region 2538 2549 N/A INTRINSIC
coiled coil region 2775 2827 N/A INTRINSIC
coiled coil region 2854 2943 N/A INTRINSIC
low complexity region 2964 2976 N/A INTRINSIC
coiled coil region 3007 3057 N/A INTRINSIC
coiled coil region 3117 3163 N/A INTRINSIC
transmembrane domain 3215 3237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114812
AA Change: S2717P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243
AA Change: S2717P

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 G T 18: 10,704,605 (GRCm39) T151K possibly damaging Het
Acsf2 C T 11: 94,463,412 (GRCm39) W130* probably null Het
Aldh16a1 G A 7: 44,797,413 (GRCm39) R132* probably null Het
Amer3 C T 1: 34,628,043 (GRCm39) P761S probably benign Het
Amotl1 G T 9: 14,459,969 (GRCm39) D886E probably damaging Het
Cacna1s T C 1: 136,035,909 (GRCm39) F1383S probably damaging Het
Col14a1 T A 15: 55,225,781 (GRCm39) V148E unknown Het
Col9a2 T A 4: 120,910,403 (GRCm39) probably null Het
Cyp2a5 T A 7: 26,536,636 (GRCm39) M205K possibly damaging Het
Dcst2 A T 3: 89,277,825 (GRCm39) Q466L possibly damaging Het
Ecel1 T C 1: 87,080,853 (GRCm39) I350V possibly damaging Het
Enthd1 G A 15: 80,336,901 (GRCm39) T511I probably benign Het
Exoc6b T A 6: 84,988,302 (GRCm39) K92* probably null Het
Fam181a T G 12: 103,282,591 (GRCm39) Y165* probably null Het
Fbxo34 A G 14: 47,768,725 (GRCm39) Y746C probably damaging Het
Fgfr4 T A 13: 55,308,994 (GRCm39) S372T possibly damaging Het
Fmo1 A G 1: 162,661,390 (GRCm39) F298L probably benign Het
Gad1 A C 2: 70,404,620 (GRCm39) D170A possibly damaging Het
Garin2 A C 12: 78,762,077 (GRCm39) D247A probably damaging Het
Golm2 T C 2: 121,737,242 (GRCm39) V261A probably benign Het
H2az2 A T 11: 6,379,094 (GRCm39) probably null Het
Ilkap A G 1: 91,303,973 (GRCm39) C163R Het
Krt9 A T 11: 100,079,186 (GRCm39) D735E unknown Het
Lipo3 A T 19: 33,559,629 (GRCm39) C80* probably null Het
Lpcat3 C T 6: 124,680,543 (GRCm39) P478L probably damaging Het
Luc7l3 G A 11: 94,212,545 (GRCm39) R24C unknown Het
Mafa T A 15: 75,619,161 (GRCm39) H204L probably benign Het
Mapk10 A C 5: 103,114,473 (GRCm39) V305G probably damaging Het
Mgat1 T C 11: 49,152,122 (GRCm39) F202L probably benign Het
Mical2 A T 7: 111,980,403 (GRCm39) T126S probably benign Het
Mill1 G A 7: 17,997,027 (GRCm39) R206H probably benign Het
Nlrc5 A T 8: 95,203,034 (GRCm39) Y378F probably benign Het
Nlrp9a G T 7: 26,250,469 (GRCm39) R78L probably damaging Het
Or10b1 G T 10: 78,356,128 (GRCm39) A229S probably benign Het
Or52i2 A T 7: 102,320,011 (GRCm39) I295F possibly damaging Het
Or8g50 A T 9: 39,648,287 (GRCm39) M59L Het
Orc6 A T 8: 86,026,430 (GRCm39) probably benign Het
Pate14 A G 9: 36,548,498 (GRCm39) probably null Het
Pcdhgb5 C T 18: 37,864,486 (GRCm39) Q94* probably null Het
Pcnx1 A G 12: 81,996,960 (GRCm39) D952G probably damaging Het
Ppfia2 A T 10: 106,749,519 (GRCm39) H1135L Het
Prmt2 A T 10: 76,061,213 (GRCm39) I91N probably damaging Het
Ptprm A G 17: 67,116,484 (GRCm39) Y932H probably damaging Het
Qrich2 T C 11: 116,337,946 (GRCm39) K154R probably damaging Het
Rapgef4 A G 2: 72,036,051 (GRCm39) T515A probably benign Het
Rgmb G A 17: 16,041,279 (GRCm39) R103* probably null Het
Ripk1 T G 13: 34,210,806 (GRCm39) S334A possibly damaging Het
Rnf5 C T 17: 34,820,721 (GRCm39) G147S possibly damaging Het
Ryr1 T C 7: 28,715,138 (GRCm39) Y4662C unknown Het
Secisbp2l A G 2: 125,589,394 (GRCm39) M718T probably damaging Het
Slc16a6 T C 11: 109,354,322 (GRCm39) T100A probably benign Het
Slc27a6 T A 18: 58,742,887 (GRCm39) M525K probably damaging Het
Slco2a1 G C 9: 102,962,065 (GRCm39) C579S probably damaging Het
Snx14 A G 9: 88,263,794 (GRCm39) S864P probably damaging Het
Spata31f3 TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 (GRCm39) probably benign Het
Sptbn2 T C 19: 4,800,535 (GRCm39) L2250P probably damaging Het
Tlr6 A T 5: 65,112,146 (GRCm39) S254T possibly damaging Het
Trap1 A T 16: 3,858,083 (GRCm39) Y675* probably null Het
Ttc9b C A 7: 27,353,512 (GRCm39) A54E probably damaging Het
Unc45a A C 7: 79,975,403 (GRCm39) Y934D probably damaging Het
Usp17ld A G 7: 102,900,179 (GRCm39) L251P possibly damaging Het
Usp42 A G 5: 143,703,154 (GRCm39) V489A probably damaging Het
Vars1 A G 17: 35,235,001 (GRCm39) T1277A unknown Het
Vmn2r117 A G 17: 23,697,450 (GRCm39) S81P probably damaging Het
Vmn2r69 T A 7: 85,061,504 (GRCm39) I157F probably benign Het
Zfp697 A G 3: 98,335,182 (GRCm39) S316G probably damaging Het
Zfp729b T A 13: 67,739,787 (GRCm39) H826L probably damaging Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36,751,926 (GRCm39) missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36,735,864 (GRCm39) nonsense probably null
IGL01965:Golgb1 APN 16 36,738,282 (GRCm39) missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36,736,666 (GRCm39) missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36,733,490 (GRCm39) missense probably benign 0.25
IGL02383:Golgb1 APN 16 36,706,562 (GRCm39) missense probably benign 0.01
IGL02444:Golgb1 APN 16 36,728,178 (GRCm39) splice site probably benign
IGL02635:Golgb1 APN 16 36,735,375 (GRCm39) missense probably benign 0.00
IGL02655:Golgb1 APN 16 36,738,442 (GRCm39) missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36,746,211 (GRCm39) missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36,736,572 (GRCm39) missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36,732,442 (GRCm39) missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36,746,172 (GRCm39) missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36,733,228 (GRCm39) missense probably benign 0.11
IGL03109:Golgb1 APN 16 36,735,973 (GRCm39) missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36,733,815 (GRCm39) nonsense probably null
I2288:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
I2289:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0080:Golgb1 UTSW 16 36,718,973 (GRCm39) missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36,695,830 (GRCm39) intron probably benign
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0276:Golgb1 UTSW 16 36,734,238 (GRCm39) missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36,695,941 (GRCm39) intron probably benign
R0469:Golgb1 UTSW 16 36,751,997 (GRCm39) missense probably benign 0.41
R0522:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R0575:Golgb1 UTSW 16 36,739,171 (GRCm39) missense probably benign
R0600:Golgb1 UTSW 16 36,736,633 (GRCm39) missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36,736,692 (GRCm39) nonsense probably null
R0711:Golgb1 UTSW 16 36,739,152 (GRCm39) missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36,719,152 (GRCm39) missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36,732,639 (GRCm39) missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36,736,488 (GRCm39) missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R1315:Golgb1 UTSW 16 36,735,262 (GRCm39) missense probably benign 0.40
R1429:Golgb1 UTSW 16 36,720,925 (GRCm39) missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36,740,005 (GRCm39) missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36,719,150 (GRCm39) missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36,746,463 (GRCm39) missense probably benign 0.25
R1659:Golgb1 UTSW 16 36,707,979 (GRCm39) missense probably benign 0.01
R1769:Golgb1 UTSW 16 36,736,363 (GRCm39) missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36,735,026 (GRCm39) missense probably benign
R2212:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36,713,722 (GRCm39) missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36,718,921 (GRCm39) missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36,732,370 (GRCm39) missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36,738,828 (GRCm39) missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36,735,513 (GRCm39) missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36,715,211 (GRCm39) missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36,739,274 (GRCm39) missense probably benign 0.00
R3847:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3850:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3936:Golgb1 UTSW 16 36,734,418 (GRCm39) nonsense probably null
R3975:Golgb1 UTSW 16 36,738,933 (GRCm39) missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36,735,706 (GRCm39) missense probably benign 0.00
R4369:Golgb1 UTSW 16 36,737,269 (GRCm39) missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36,749,625 (GRCm39) missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36,707,980 (GRCm39) missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36,711,781 (GRCm39) missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36,733,477 (GRCm39) missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36,711,769 (GRCm39) missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36,713,748 (GRCm39) missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36,736,480 (GRCm39) missense probably benign 0.05
R5121:Golgb1 UTSW 16 36,739,620 (GRCm39) missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36,711,819 (GRCm39) missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36,719,051 (GRCm39) missense probably benign 0.09
R5185:Golgb1 UTSW 16 36,695,503 (GRCm39) unclassified probably benign
R5188:Golgb1 UTSW 16 36,738,827 (GRCm39) missense probably benign 0.13
R5260:Golgb1 UTSW 16 36,733,503 (GRCm39) missense probably benign 0.00
R5297:Golgb1 UTSW 16 36,695,978 (GRCm39) intron probably benign
R5386:Golgb1 UTSW 16 36,732,677 (GRCm39) nonsense probably null
R5438:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5439:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5494:Golgb1 UTSW 16 36,749,045 (GRCm39) missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36,746,125 (GRCm39) missense probably benign 0.02
R5740:Golgb1 UTSW 16 36,739,362 (GRCm39) missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36,746,453 (GRCm39) splice site silent
R5928:Golgb1 UTSW 16 36,732,349 (GRCm39) missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36,735,321 (GRCm39) missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36,735,033 (GRCm39) missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36,733,227 (GRCm39) missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36,713,757 (GRCm39) missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36,735,984 (GRCm39) missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36,734,340 (GRCm39) missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36,738,559 (GRCm39) nonsense probably null
R6700:Golgb1 UTSW 16 36,695,946 (GRCm39) intron probably benign
R6870:Golgb1 UTSW 16 36,738,565 (GRCm39) missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36,734,352 (GRCm39) missense probably benign
R6944:Golgb1 UTSW 16 36,732,475 (GRCm39) missense probably benign
R7108:Golgb1 UTSW 16 36,734,083 (GRCm39) missense probably benign 0.01
R7124:Golgb1 UTSW 16 36,734,035 (GRCm39) missense probably benign 0.01
R7125:Golgb1 UTSW 16 36,738,325 (GRCm39) missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36,736,512 (GRCm39) missense probably benign 0.43
R7205:Golgb1 UTSW 16 36,695,663 (GRCm39) missense unknown
R7206:Golgb1 UTSW 16 36,734,111 (GRCm39) missense probably benign 0.41
R7233:Golgb1 UTSW 16 36,735,120 (GRCm39) missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36,736,313 (GRCm39) nonsense probably null
R7367:Golgb1 UTSW 16 36,718,908 (GRCm39) missense probably benign 0.00
R7408:Golgb1 UTSW 16 36,718,909 (GRCm39) missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36,733,281 (GRCm39) missense possibly damaging 0.95
R7556:Golgb1 UTSW 16 36,736,155 (GRCm39) missense probably benign 0.03
R7599:Golgb1 UTSW 16 36,695,758 (GRCm39) missense unknown
R7673:Golgb1 UTSW 16 36,734,031 (GRCm39) missense probably benign 0.05
R7789:Golgb1 UTSW 16 36,695,761 (GRCm39) missense unknown
R7792:Golgb1 UTSW 16 36,739,092 (GRCm39) missense probably benign 0.43
R7830:Golgb1 UTSW 16 36,719,083 (GRCm39) missense possibly damaging 0.93
R7847:Golgb1 UTSW 16 36,752,282 (GRCm39) missense probably damaging 1.00
R7905:Golgb1 UTSW 16 36,734,047 (GRCm39) missense probably benign
R7944:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7945:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7950:Golgb1 UTSW 16 36,735,786 (GRCm39) missense probably benign 0.13
R8040:Golgb1 UTSW 16 36,733,841 (GRCm39) missense possibly damaging 0.85
R8077:Golgb1 UTSW 16 36,738,995 (GRCm39) missense probably damaging 0.99
R8181:Golgb1 UTSW 16 36,737,192 (GRCm39) missense probably damaging 1.00
R8370:Golgb1 UTSW 16 36,732,679 (GRCm39) missense probably benign 0.00
R8684:Golgb1 UTSW 16 36,734,764 (GRCm39) missense possibly damaging 0.92
R8725:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8727:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8738:Golgb1 UTSW 16 36,736,675 (GRCm39) missense probably damaging 1.00
R8785:Golgb1 UTSW 16 36,740,106 (GRCm39) missense probably damaging 0.99
R8824:Golgb1 UTSW 16 36,736,051 (GRCm39) missense probably benign
R8825:Golgb1 UTSW 16 36,739,809 (GRCm39) missense probably benign 0.00
R8940:Golgb1 UTSW 16 36,736,759 (GRCm39) missense probably damaging 1.00
R8962:Golgb1 UTSW 16 36,733,978 (GRCm39) missense probably damaging 1.00
R9245:Golgb1 UTSW 16 36,739,181 (GRCm39) nonsense probably null
R9365:Golgb1 UTSW 16 36,736,124 (GRCm39) missense probably damaging 1.00
R9612:Golgb1 UTSW 16 36,739,967 (GRCm39) missense probably benign 0.41
R9691:Golgb1 UTSW 16 36,718,996 (GRCm39) missense probably damaging 1.00
R9747:Golgb1 UTSW 16 36,713,769 (GRCm39) missense probably damaging 1.00
V1662:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
X0067:Golgb1 UTSW 16 36,734,665 (GRCm39) nonsense probably null
Z1088:Golgb1 UTSW 16 36,740,104 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAAGTTGCTTACGGTAACC -3'
(R):5'- AGCTCACTCCATAGGCGATC -3'

Sequencing Primer
(F):5'- GTTGCTTACGGTAACCAAAGAG -3'
(R):5'- CTCATTCTGTAGACTGGTCATGGC -3'
Posted On 2022-09-12