Incidental Mutation 'R9621:Pik3c2b'
ID 724760
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms C330011J12Rik, PI3K-C2beta
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock # R9621 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 133045667-133108687 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 133071607 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 398 (S398P)
Ref Sequence ENSEMBL: ENSMUSP00000076911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730] [ENSMUST00000153707]
AlphaFold E9QAN8
Predicted Effect probably damaging
Transcript: ENSMUST00000077730
AA Change: S398P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: S398P

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153707
SMART Domains Protein: ENSMUSP00000115469
Gene: ENSMUSG00000026447

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik C A 12: 55,382,257 H538N probably benign Het
2410131K14Rik C T 5: 118,255,815 T86I possibly damaging Het
Abca1 T C 4: 53,092,918 T289A probably benign Het
Adnp A T 2: 168,182,743 S877R probably benign Het
Akap13 T A 7: 75,736,342 H555Q probably benign Het
Alg6 T A 4: 99,726,894 Y38* probably null Het
Amtn C A 5: 88,380,346 Q93K probably benign Het
Ap2b1 T C 11: 83,402,598 V937A probably damaging Het
Arih1 ATCGTCCGGCTCGTCCTCGTCGTCGTCC ATCGTCC 9: 59,486,237 probably benign Het
Bhmt A G 13: 93,621,571 S211P possibly damaging Het
Bmp1 T C 14: 70,477,866 Y943C probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Cbfb A C 8: 105,178,611 T62P probably damaging Het
Ccdc154 T C 17: 25,167,381 F249L probably damaging Het
Cdh26 T A 2: 178,470,190 F514L probably damaging Het
Cdhr2 A G 13: 54,718,537 E352G Het
Cep295nl G A 11: 118,333,940 P26L possibly damaging Het
Cfdp1 A G 8: 111,845,175 V34A probably damaging Het
Cntnap2 A T 6: 46,988,792 I846F probably damaging Het
Cntrl A G 2: 35,160,266 K1464E probably damaging Het
Crybg3 T C 16: 59,506,250 D1039G possibly damaging Het
Csmd3 A T 15: 47,849,720 S778R Het
Daam2 C T 17: 49,473,304 C729Y probably damaging Het
Ddx18 T C 1: 121,561,403 H305R probably damaging Het
Dio1 C T 4: 107,292,361 C248Y probably benign Het
Dnah1 C A 14: 31,294,815 A1582S probably damaging Het
Eef1a1 A T 9: 78,479,350 D319E probably benign Het
Fam171b G A 2: 83,812,765 R6H probably damaging Het
Fam214a A G 9: 75,010,230 N711D possibly damaging Het
Flnb G A 14: 7,926,421 G1822R probably damaging Het
Gabrb1 G A 5: 72,122,020 V303I possibly damaging Het
Gli3 T G 13: 15,726,668 S1547A probably benign Het
Gm4884 A T 7: 41,043,687 N360I possibly damaging Het
Gm9573 T A 17: 35,621,828 T489S unknown Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Ino80 C G 2: 119,450,015 K289N probably damaging Het
Itpr1 G A 6: 108,416,909 E1638K probably damaging Het
Jakmip1 A T 5: 37,117,468 I45F unknown Het
Kif1a G A 1: 93,055,723 P684L probably benign Het
Kpnb1 A T 11: 97,167,634 S610T probably benign Het
Man1a2 A G 3: 100,684,645 V73A probably benign Het
Mbtps1 A G 8: 119,508,882 V1019A possibly damaging Het
Nup210 G C 6: 91,017,393 N1774K probably benign Het
Olfr763 G T 10: 129,011,890 V202F probably benign Het
Pmpca A G 2: 26,389,976 T37A probably benign Het
Ppfia1 A G 7: 144,498,779 S840P probably damaging Het
Prkcq A T 2: 11,256,203 K355N probably benign Het
Ptprg A G 14: 12,237,809 K1422R probably benign Het
Ptprq T C 10: 107,542,662 E2006G probably damaging Het
Qsox1 TG T 1: 155,795,389 probably null Het
Rcor2 A T 19: 7,274,226 T412S probably benign Het
Rnf224 A T 2: 25,236,188 M51K probably benign Het
Robo4 A G 9: 37,406,213 D521G probably damaging Het
Sf3b4 T A 3: 96,176,799 S360T unknown Het
Sgo2b T C 8: 63,927,617 D727G probably damaging Het
Smpd2 C A 10: 41,488,287 V172L probably benign Het
Syne1 C T 10: 5,323,887 A1966T probably benign Het
Syt13 G A 2: 92,915,230 G15D possibly damaging Het
Taf3 A T 2: 9,918,259 L18Q unknown Het
Tcam1 T A 11: 106,285,433 N328K probably damaging Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tet2 A T 3: 133,488,006 Y222* probably null Het
Timm29 A T 9: 21,592,922 probably benign Het
Tmc6 T C 11: 117,779,169 D17G probably benign Het
Tmem30a T A 9: 79,780,644 D81V probably benign Het
Tnnt1 T C 7: 4,508,502 I195V probably benign Het
Ttc30b T C 2: 75,937,800 Y203C probably damaging Het
Ttll5 T A 12: 85,892,122 V398E possibly damaging Het
Ttn T C 2: 76,918,097 T4203A possibly damaging Het
Ubc A G 5: 125,387,447 I272T probably damaging Het
Uhrf1bp1 T A 17: 27,886,779 S760T probably benign Het
Unc45a A G 7: 80,334,037 L337P probably damaging Het
Vmn1r229 T C 17: 20,815,053 F187L probably benign Het
Wrn A T 8: 33,324,273 M381K probably benign Het
Zdbf2 A G 1: 63,303,476 N338S possibly damaging Het
Zfp541 A G 7: 16,071,967 E9G possibly damaging Het
Zrsr1 G A 11: 22,973,418 R64Q possibly damaging Het
Zswim8 T A 14: 20,722,163 S1614T probably benign Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133091618 missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133094805 missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 133071631 nonsense probably null
IGL01367:Pik3c2b APN 1 133105988 missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133094791 missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133077318 splice site probably benign
IGL02728:Pik3c2b APN 1 133092327 missense probably benign 0.09
IGL02992:Pik3c2b APN 1 133066980 nonsense probably null
IGL03121:Pik3c2b APN 1 133079745 missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133077396 missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133105992 missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133100831 missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 133071200 missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133090034 missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133094826 missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1729:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1730:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1739:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1762:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1783:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1784:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1785:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133101370 missense probably benign 0.00
R1897:Pik3c2b UTSW 1 133066916 missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 133066544 missense probably damaging 1.00
R2067:Pik3c2b UTSW 1 133099611 missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133103428 missense probably benign
R2294:Pik3c2b UTSW 1 133066775 missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133103413 missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 133067049 missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133099626 nonsense probably null
R4948:Pik3c2b UTSW 1 133099715 critical splice donor site probably null
R4997:Pik3c2b UTSW 1 133105081 missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 133070408 missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133099702 missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133103836 missense probably damaging 1.00
R5971:Pik3c2b UTSW 1 133074627 splice site probably null
R5980:Pik3c2b UTSW 1 133088308 missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133090713 missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133074627 splice site probably null
R6223:Pik3c2b UTSW 1 133070357 missense probably damaging 1.00
R6273:Pik3c2b UTSW 1 133066711 missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133075821 missense probably benign
R6954:Pik3c2b UTSW 1 133066303 missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133102372 missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133105974 missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133090234 missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133106112 missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 133066465 missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133079774 missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133094734 missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133090202 missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133090706 missense probably damaging 1.00
R7709:Pik3c2b UTSW 1 133079841 critical splice donor site probably null
R7712:Pik3c2b UTSW 1 133085611 missense probably damaging 1.00
R7823:Pik3c2b UTSW 1 133102305 missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 133071242 missense possibly damaging 0.94
R7913:Pik3c2b UTSW 1 133090061 critical splice donor site probably null
R7916:Pik3c2b UTSW 1 133100904 missense probably benign 0.30
R7960:Pik3c2b UTSW 1 133103849 missense probably damaging 1.00
R7981:Pik3c2b UTSW 1 133075809 critical splice acceptor site probably null
R8346:Pik3c2b UTSW 1 133090246 missense probably damaging 0.97
R8938:Pik3c2b UTSW 1 133088330 missense probably benign 0.19
R8997:Pik3c2b UTSW 1 133090779 missense possibly damaging 0.83
R9416:Pik3c2b UTSW 1 133077449 missense probably damaging 1.00
R9598:Pik3c2b UTSW 1 133084987 critical splice donor site probably null
R9742:Pik3c2b UTSW 1 133094749 missense probably damaging 1.00
R9776:Pik3c2b UTSW 1 133090850 missense possibly damaging 0.64
R9786:Pik3c2b UTSW 1 133091600 missense possibly damaging 0.94
U15987:Pik3c2b UTSW 1 133074627 splice site probably null
X0060:Pik3c2b UTSW 1 133084936 missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133066553 missense probably damaging 1.00
Z1176:Pik3c2b UTSW 1 133099686 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGGCAGGGAGGACTATTC -3'
(R):5'- CCAGAAGGCAAGTGTCACTTC -3'

Sequencing Primer
(F):5'- TCTGTCGCCTGAATGAAGAC -3'
(R):5'- GAAGGCAAGTGTCACTTCAGTCTC -3'
Posted On 2022-09-12