Incidental Mutation 'R9621:Pik3c2b'
ID 724760
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms PI3K-C2beta, C330011J12Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.253) question?
Stock # R9621 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 132973410-133036429 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 132999345 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 398 (S398P)
Ref Sequence ENSEMBL: ENSMUSP00000076911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730] [ENSMUST00000153707]
AlphaFold E9QAN8
Predicted Effect probably damaging
Transcript: ENSMUST00000077730
AA Change: S398P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: S398P

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153707
SMART Domains Protein: ENSMUSP00000115469
Gene: ENSMUSG00000026447

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,092,918 (GRCm39) T289A probably benign Het
Adnp A T 2: 168,024,663 (GRCm39) S877R probably benign Het
Akap13 T A 7: 75,386,090 (GRCm39) H555Q probably benign Het
Alg6 T A 4: 99,615,131 (GRCm39) Y38* probably null Het
Amtn C A 5: 88,528,205 (GRCm39) Q93K probably benign Het
Ap2b1 T C 11: 83,293,424 (GRCm39) V937A probably damaging Het
Arih1 ATCGTCCGGCTCGTCCTCGTCGTCGTCC ATCGTCC 9: 59,393,520 (GRCm39) probably benign Het
Atosa A G 9: 74,917,512 (GRCm39) N711D possibly damaging Het
Bhmt A G 13: 93,758,079 (GRCm39) S211P possibly damaging Het
Bltp3a T A 17: 28,105,753 (GRCm39) S760T probably benign Het
Bmp1 T C 14: 70,715,306 (GRCm39) Y943C probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 95,990,862 (GRCm39) probably null Het
Cbfb A C 8: 105,905,243 (GRCm39) T62P probably damaging Het
Ccdc154 T C 17: 25,386,355 (GRCm39) F249L probably damaging Het
Cdh26 T A 2: 178,111,983 (GRCm39) F514L probably damaging Het
Cdhr2 A G 13: 54,866,350 (GRCm39) E352G Het
Cep295nl G A 11: 118,224,766 (GRCm39) P26L possibly damaging Het
Cfdp1 A G 8: 112,571,807 (GRCm39) V34A probably damaging Het
Cntnap2 A T 6: 46,965,726 (GRCm39) I846F probably damaging Het
Cntrl A G 2: 35,050,278 (GRCm39) K1464E probably damaging Het
Crybg3 T C 16: 59,326,613 (GRCm39) D1039G possibly damaging Het
Csmd3 A T 15: 47,713,116 (GRCm39) S778R Het
Daam2 C T 17: 49,780,332 (GRCm39) C729Y probably damaging Het
Ddx18 T C 1: 121,489,132 (GRCm39) H305R probably damaging Het
Dio1 C T 4: 107,149,558 (GRCm39) C248Y probably benign Het
Dnah1 C A 14: 31,016,772 (GRCm39) A1582S probably damaging Het
Eef1a1 A T 9: 78,386,632 (GRCm39) D319E probably benign Het
Fam171b G A 2: 83,643,109 (GRCm39) R6H probably damaging Het
Flnb G A 14: 7,926,421 (GRCm38) G1822R probably damaging Het
Gabrb1 G A 5: 72,279,363 (GRCm39) V303I possibly damaging Het
Gli3 T G 13: 15,901,253 (GRCm39) S1547A probably benign Het
Gm4884 A T 7: 40,693,111 (GRCm39) N360I possibly damaging Het
Ift70b T C 2: 75,768,144 (GRCm39) Y203C probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,366,470 (GRCm39) probably benign Het
Ino80 C G 2: 119,280,496 (GRCm39) K289N probably damaging Het
Itpr1 G A 6: 108,393,870 (GRCm39) E1638K probably damaging Het
Jakmip1 A T 5: 37,274,812 (GRCm39) I45F unknown Het
Kif1a G A 1: 92,983,445 (GRCm39) P684L probably benign Het
Kpnb1 A T 11: 97,058,460 (GRCm39) S610T probably benign Het
Man1a2 A G 3: 100,591,961 (GRCm39) V73A probably benign Het
Mbtps1 A G 8: 120,235,621 (GRCm39) V1019A possibly damaging Het
Muc21 T A 17: 35,932,720 (GRCm39) T489S unknown Het
Nup210 G C 6: 90,994,375 (GRCm39) N1774K probably benign Het
Or10p21 G T 10: 128,847,759 (GRCm39) V202F probably benign Het
Pmpca A G 2: 26,279,988 (GRCm39) T37A probably benign Het
Ppfia1 A G 7: 144,052,516 (GRCm39) S840P probably damaging Het
Prkcq A T 2: 11,261,014 (GRCm39) K355N probably benign Het
Prorp C A 12: 55,429,042 (GRCm39) H538N probably benign Het
Ptprg A G 14: 12,237,809 (GRCm38) K1422R probably benign Het
Ptprq T C 10: 107,378,523 (GRCm39) E2006G probably damaging Het
Qsox1 TG T 1: 155,671,135 (GRCm39) probably null Het
Rcor2 A T 19: 7,251,591 (GRCm39) T412S probably benign Het
Rnf224 A T 2: 25,126,200 (GRCm39) M51K probably benign Het
Robo4 A G 9: 37,317,509 (GRCm39) D521G probably damaging Het
Sf3b4 T A 3: 96,084,115 (GRCm39) S360T unknown Het
Sgo2b T C 8: 64,380,651 (GRCm39) D727G probably damaging Het
Smpd2 C A 10: 41,364,283 (GRCm39) V172L probably benign Het
Spring1 C T 5: 118,393,880 (GRCm39) T86I possibly damaging Het
Syne1 C T 10: 5,273,887 (GRCm39) A1966T probably benign Het
Syt13 G A 2: 92,745,575 (GRCm39) G15D possibly damaging Het
Taf3 A T 2: 9,923,070 (GRCm39) L18Q unknown Het
Tcam1 T A 11: 106,176,259 (GRCm39) N328K probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tet2 A T 3: 133,193,767 (GRCm39) Y222* probably null Het
Timm29 A T 9: 21,504,218 (GRCm39) probably benign Het
Tmc6 T C 11: 117,669,995 (GRCm39) D17G probably benign Het
Tmem30a T A 9: 79,687,926 (GRCm39) D81V probably benign Het
Tnnt1 T C 7: 4,511,501 (GRCm39) I195V probably benign Het
Ttll5 T A 12: 85,938,896 (GRCm39) V398E possibly damaging Het
Ttn T C 2: 76,748,441 (GRCm39) T4203A possibly damaging Het
Ubc A G 5: 125,464,511 (GRCm39) I272T probably damaging Het
Unc45a A G 7: 79,983,785 (GRCm39) L337P probably damaging Het
Vmn1r229 T C 17: 21,035,315 (GRCm39) F187L probably benign Het
Wrn A T 8: 33,814,301 (GRCm39) M381K probably benign Het
Zdbf2 A G 1: 63,342,635 (GRCm39) N338S possibly damaging Het
Zfp541 A G 7: 15,805,892 (GRCm39) E9G possibly damaging Het
Zrsr2-ps1 G A 11: 22,923,418 (GRCm39) R64Q possibly damaging Het
Zswim8 T A 14: 20,772,231 (GRCm39) S1614T probably benign Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133,019,356 (GRCm39) missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133,022,543 (GRCm39) missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 132,999,369 (GRCm39) nonsense probably null
IGL01367:Pik3c2b APN 1 133,033,726 (GRCm39) missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133,022,529 (GRCm39) missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133,005,056 (GRCm39) splice site probably benign
IGL02728:Pik3c2b APN 1 133,020,065 (GRCm39) missense probably benign 0.09
IGL02992:Pik3c2b APN 1 132,994,718 (GRCm39) nonsense probably null
IGL03121:Pik3c2b APN 1 133,007,483 (GRCm39) missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133,005,134 (GRCm39) missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133,033,730 (GRCm39) missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133,028,569 (GRCm39) missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 132,998,938 (GRCm39) missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133,017,772 (GRCm39) missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133,022,564 (GRCm39) missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1729:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1730:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1739:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1762:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1783:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1784:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1785:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133,029,108 (GRCm39) missense probably benign 0.00
R1897:Pik3c2b UTSW 1 132,994,654 (GRCm39) missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 132,994,282 (GRCm39) missense probably damaging 1.00
R2067:Pik3c2b UTSW 1 133,027,349 (GRCm39) missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133,031,166 (GRCm39) missense probably benign
R2294:Pik3c2b UTSW 1 132,994,513 (GRCm39) missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133,031,151 (GRCm39) missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 132,994,787 (GRCm39) missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133,027,364 (GRCm39) nonsense probably null
R4948:Pik3c2b UTSW 1 133,027,453 (GRCm39) critical splice donor site probably null
R4997:Pik3c2b UTSW 1 133,032,819 (GRCm39) missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 132,998,146 (GRCm39) missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133,027,440 (GRCm39) missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133,031,574 (GRCm39) missense probably damaging 1.00
R5971:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R5980:Pik3c2b UTSW 1 133,016,046 (GRCm39) missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133,018,451 (GRCm39) missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R6223:Pik3c2b UTSW 1 132,998,095 (GRCm39) missense probably damaging 1.00
R6273:Pik3c2b UTSW 1 132,994,449 (GRCm39) missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133,003,559 (GRCm39) missense probably benign
R6954:Pik3c2b UTSW 1 132,994,041 (GRCm39) missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133,030,110 (GRCm39) missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133,033,712 (GRCm39) missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133,017,972 (GRCm39) missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133,033,850 (GRCm39) missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 132,994,203 (GRCm39) missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133,007,512 (GRCm39) missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133,022,472 (GRCm39) missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133,017,940 (GRCm39) missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133,018,444 (GRCm39) missense probably damaging 1.00
R7709:Pik3c2b UTSW 1 133,007,579 (GRCm39) critical splice donor site probably null
R7712:Pik3c2b UTSW 1 133,013,349 (GRCm39) missense probably damaging 1.00
R7823:Pik3c2b UTSW 1 133,030,043 (GRCm39) missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 132,998,980 (GRCm39) missense possibly damaging 0.94
R7913:Pik3c2b UTSW 1 133,017,799 (GRCm39) critical splice donor site probably null
R7916:Pik3c2b UTSW 1 133,028,642 (GRCm39) missense probably benign 0.30
R7960:Pik3c2b UTSW 1 133,031,587 (GRCm39) missense probably damaging 1.00
R7981:Pik3c2b UTSW 1 133,003,547 (GRCm39) critical splice acceptor site probably null
R8346:Pik3c2b UTSW 1 133,017,984 (GRCm39) missense probably damaging 0.97
R8938:Pik3c2b UTSW 1 133,016,068 (GRCm39) missense probably benign 0.19
R8997:Pik3c2b UTSW 1 133,018,517 (GRCm39) missense possibly damaging 0.83
R9416:Pik3c2b UTSW 1 133,005,187 (GRCm39) missense probably damaging 1.00
R9598:Pik3c2b UTSW 1 133,012,725 (GRCm39) critical splice donor site probably null
R9742:Pik3c2b UTSW 1 133,022,487 (GRCm39) missense probably damaging 1.00
R9776:Pik3c2b UTSW 1 133,018,588 (GRCm39) missense possibly damaging 0.64
R9786:Pik3c2b UTSW 1 133,019,338 (GRCm39) missense possibly damaging 0.94
U15987:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
X0060:Pik3c2b UTSW 1 133,012,674 (GRCm39) missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133,027,424 (GRCm39) nonsense probably null
Z1176:Pik3c2b UTSW 1 132,994,291 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGCAGGGAGGACTATTC -3'
(R):5'- CCAGAAGGCAAGTGTCACTTC -3'

Sequencing Primer
(F):5'- TCTGTCGCCTGAATGAAGAC -3'
(R):5'- GAAGGCAAGTGTCACTTCAGTCTC -3'
Posted On 2022-09-12