Incidental Mutation 'R9621:Cntnap2'
ID 724786
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms Caspr2, 5430425M22Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9621 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 45036995-47278330 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 46965726 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 846 (I846F)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000114641
AA Change: I846F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: I846F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,092,918 (GRCm39) T289A probably benign Het
Adnp A T 2: 168,024,663 (GRCm39) S877R probably benign Het
Akap13 T A 7: 75,386,090 (GRCm39) H555Q probably benign Het
Alg6 T A 4: 99,615,131 (GRCm39) Y38* probably null Het
Amtn C A 5: 88,528,205 (GRCm39) Q93K probably benign Het
Ap2b1 T C 11: 83,293,424 (GRCm39) V937A probably damaging Het
Arih1 ATCGTCCGGCTCGTCCTCGTCGTCGTCC ATCGTCC 9: 59,393,520 (GRCm39) probably benign Het
Atosa A G 9: 74,917,512 (GRCm39) N711D possibly damaging Het
Bhmt A G 13: 93,758,079 (GRCm39) S211P possibly damaging Het
Bltp3a T A 17: 28,105,753 (GRCm39) S760T probably benign Het
Bmp1 T C 14: 70,715,306 (GRCm39) Y943C probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 95,990,862 (GRCm39) probably null Het
Cbfb A C 8: 105,905,243 (GRCm39) T62P probably damaging Het
Ccdc154 T C 17: 25,386,355 (GRCm39) F249L probably damaging Het
Cdh26 T A 2: 178,111,983 (GRCm39) F514L probably damaging Het
Cdhr2 A G 13: 54,866,350 (GRCm39) E352G Het
Cep295nl G A 11: 118,224,766 (GRCm39) P26L possibly damaging Het
Cfdp1 A G 8: 112,571,807 (GRCm39) V34A probably damaging Het
Cntrl A G 2: 35,050,278 (GRCm39) K1464E probably damaging Het
Crybg3 T C 16: 59,326,613 (GRCm39) D1039G possibly damaging Het
Csmd3 A T 15: 47,713,116 (GRCm39) S778R Het
Daam2 C T 17: 49,780,332 (GRCm39) C729Y probably damaging Het
Ddx18 T C 1: 121,489,132 (GRCm39) H305R probably damaging Het
Dio1 C T 4: 107,149,558 (GRCm39) C248Y probably benign Het
Dnah1 C A 14: 31,016,772 (GRCm39) A1582S probably damaging Het
Eef1a1 A T 9: 78,386,632 (GRCm39) D319E probably benign Het
Fam171b G A 2: 83,643,109 (GRCm39) R6H probably damaging Het
Flnb G A 14: 7,926,421 (GRCm38) G1822R probably damaging Het
Gabrb1 G A 5: 72,279,363 (GRCm39) V303I possibly damaging Het
Gli3 T G 13: 15,901,253 (GRCm39) S1547A probably benign Het
Gm4884 A T 7: 40,693,111 (GRCm39) N360I possibly damaging Het
Ift70b T C 2: 75,768,144 (GRCm39) Y203C probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,366,470 (GRCm39) probably benign Het
Ino80 C G 2: 119,280,496 (GRCm39) K289N probably damaging Het
Itpr1 G A 6: 108,393,870 (GRCm39) E1638K probably damaging Het
Jakmip1 A T 5: 37,274,812 (GRCm39) I45F unknown Het
Kif1a G A 1: 92,983,445 (GRCm39) P684L probably benign Het
Kpnb1 A T 11: 97,058,460 (GRCm39) S610T probably benign Het
Man1a2 A G 3: 100,591,961 (GRCm39) V73A probably benign Het
Mbtps1 A G 8: 120,235,621 (GRCm39) V1019A possibly damaging Het
Muc21 T A 17: 35,932,720 (GRCm39) T489S unknown Het
Nup210 G C 6: 90,994,375 (GRCm39) N1774K probably benign Het
Or10p21 G T 10: 128,847,759 (GRCm39) V202F probably benign Het
Pik3c2b T C 1: 132,999,345 (GRCm39) S398P probably damaging Het
Pmpca A G 2: 26,279,988 (GRCm39) T37A probably benign Het
Ppfia1 A G 7: 144,052,516 (GRCm39) S840P probably damaging Het
Prkcq A T 2: 11,261,014 (GRCm39) K355N probably benign Het
Prorp C A 12: 55,429,042 (GRCm39) H538N probably benign Het
Ptprg A G 14: 12,237,809 (GRCm38) K1422R probably benign Het
Ptprq T C 10: 107,378,523 (GRCm39) E2006G probably damaging Het
Qsox1 TG T 1: 155,671,135 (GRCm39) probably null Het
Rcor2 A T 19: 7,251,591 (GRCm39) T412S probably benign Het
Rnf224 A T 2: 25,126,200 (GRCm39) M51K probably benign Het
Robo4 A G 9: 37,317,509 (GRCm39) D521G probably damaging Het
Sf3b4 T A 3: 96,084,115 (GRCm39) S360T unknown Het
Sgo2b T C 8: 64,380,651 (GRCm39) D727G probably damaging Het
Smpd2 C A 10: 41,364,283 (GRCm39) V172L probably benign Het
Spring1 C T 5: 118,393,880 (GRCm39) T86I possibly damaging Het
Syne1 C T 10: 5,273,887 (GRCm39) A1966T probably benign Het
Syt13 G A 2: 92,745,575 (GRCm39) G15D possibly damaging Het
Taf3 A T 2: 9,923,070 (GRCm39) L18Q unknown Het
Tcam1 T A 11: 106,176,259 (GRCm39) N328K probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tet2 A T 3: 133,193,767 (GRCm39) Y222* probably null Het
Timm29 A T 9: 21,504,218 (GRCm39) probably benign Het
Tmc6 T C 11: 117,669,995 (GRCm39) D17G probably benign Het
Tmem30a T A 9: 79,687,926 (GRCm39) D81V probably benign Het
Tnnt1 T C 7: 4,511,501 (GRCm39) I195V probably benign Het
Ttll5 T A 12: 85,938,896 (GRCm39) V398E possibly damaging Het
Ttn T C 2: 76,748,441 (GRCm39) T4203A possibly damaging Het
Ubc A G 5: 125,464,511 (GRCm39) I272T probably damaging Het
Unc45a A G 7: 79,983,785 (GRCm39) L337P probably damaging Het
Vmn1r229 T C 17: 21,035,315 (GRCm39) F187L probably benign Het
Wrn A T 8: 33,814,301 (GRCm39) M381K probably benign Het
Zdbf2 A G 1: 63,342,635 (GRCm39) N338S possibly damaging Het
Zfp541 A G 7: 15,805,892 (GRCm39) E9G possibly damaging Het
Zrsr2-ps1 G A 11: 22,923,418 (GRCm39) R64Q possibly damaging Het
Zswim8 T A 14: 20,772,231 (GRCm39) S1614T probably benign Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 45,992,197 (GRCm39) missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46,965,721 (GRCm39) missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47,169,972 (GRCm39) missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46,461,006 (GRCm39) missense probably benign
IGL00857:Cntnap2 APN 6 47,026,358 (GRCm39) missense probably benign 0.00
IGL01290:Cntnap2 APN 6 45,992,399 (GRCm39) missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47,169,947 (GRCm39) missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47,248,305 (GRCm39) nonsense probably null
IGL01859:Cntnap2 APN 6 46,965,655 (GRCm39) missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46,211,137 (GRCm39) missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 46,998,588 (GRCm39) missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46,211,254 (GRCm39) missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 46,998,670 (GRCm39) missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47,072,483 (GRCm39) missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46,147,179 (GRCm39) missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46,507,105 (GRCm39) missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45,969,007 (GRCm39) missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45,969,007 (GRCm39) missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46,460,917 (GRCm39) missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45,037,326 (GRCm39) splice site probably null
R0352:Cntnap2 UTSW 6 45,969,018 (GRCm39) splice site probably null
R0389:Cntnap2 UTSW 6 45,986,571 (GRCm39) missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45,692,750 (GRCm39) missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46,506,839 (GRCm39) nonsense probably null
R0611:Cntnap2 UTSW 6 47,072,483 (GRCm39) missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46,965,694 (GRCm39) missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47,273,642 (GRCm39) splice site probably benign
R0976:Cntnap2 UTSW 6 47,248,164 (GRCm39) missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1387:Cntnap2 UTSW 6 47,084,848 (GRCm39) missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46,507,613 (GRCm39) missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 45,992,264 (GRCm39) missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47,084,826 (GRCm39) nonsense probably null
R1757:Cntnap2 UTSW 6 46,736,763 (GRCm39) missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46,965,609 (GRCm39) missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46,507,567 (GRCm39) missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47,275,522 (GRCm39) missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47,275,379 (GRCm39) missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 45,992,200 (GRCm39) missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45,968,837 (GRCm39) missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46,833,062 (GRCm39) missense probably benign
R4030:Cntnap2 UTSW 6 46,833,062 (GRCm39) missense probably benign
R4237:Cntnap2 UTSW 6 46,507,324 (GRCm39) intron probably benign
R4445:Cntnap2 UTSW 6 46,736,785 (GRCm39) missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45,037,251 (GRCm39) missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45,037,251 (GRCm39) missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46,506,969 (GRCm39) intron probably benign
R4918:Cntnap2 UTSW 6 46,506,969 (GRCm39) intron probably benign
R4999:Cntnap2 UTSW 6 45,897,768 (GRCm39) missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47,084,903 (GRCm39) missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47,084,903 (GRCm39) missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45,897,860 (GRCm39) nonsense probably null
R5748:Cntnap2 UTSW 6 45,692,818 (GRCm39) missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46,506,749 (GRCm39) intron probably benign
R6118:Cntnap2 UTSW 6 47,170,011 (GRCm39) missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46,736,742 (GRCm39) missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47,248,232 (GRCm39) missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45,037,046 (GRCm39) splice site probably null
R6385:Cntnap2 UTSW 6 46,833,114 (GRCm39) missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46,736,694 (GRCm39) missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46,147,206 (GRCm39) missense probably benign 0.25
R6610:Cntnap2 UTSW 6 45,992,191 (GRCm39) missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47,026,307 (GRCm39) missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46,965,580 (GRCm39) missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47,248,205 (GRCm39) missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46,460,963 (GRCm39) missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46,324,079 (GRCm39) missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47,072,627 (GRCm39) missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47,026,307 (GRCm39) missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46,736,707 (GRCm39) missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45,968,975 (GRCm39) missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47,026,156 (GRCm39) missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 45,978,161 (GRCm39) missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46,833,076 (GRCm39) missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46,460,983 (GRCm39) missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46,461,139 (GRCm39) intron probably benign
R9209:Cntnap2 UTSW 6 47,026,183 (GRCm39) missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 45,978,112 (GRCm39) missense probably benign 0.00
R9310:Cntnap2 UTSW 6 45,978,281 (GRCm39) missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 45,978,244 (GRCm39) missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46,211,217 (GRCm39) missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 45,992,165 (GRCm39) missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45,969,009 (GRCm39) missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 45,992,373 (GRCm39) frame shift probably null
R9745:Cntnap2 UTSW 6 46,211,100 (GRCm39) missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47,026,261 (GRCm39) missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 46,998,599 (GRCm39) missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 45,986,452 (GRCm39) missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 46,998,688 (GRCm39) missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46,211,179 (GRCm39) missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47,248,082 (GRCm39) missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 45,992,233 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGTACACAATAACTCGTCTTCTCTC -3'
(R):5'- CAGGCTGGTTTACACACCTCTG -3'

Sequencing Primer
(F):5'- GTCTTCTCTCTTTATCCCACAGG -3'
(R):5'- GCTGGTTTACACACCTCTGACTAC -3'
Posted On 2022-09-12