Incidental Mutation 'R9621:Cntnap2'
ID 724786
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms 5430425M22Rik, Caspr2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9621 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 45059357-47304213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 46988792 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 846 (I846F)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000114641
AA Change: I846F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: I846F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik C A 12: 55,382,257 H538N probably benign Het
2410131K14Rik C T 5: 118,255,815 T86I possibly damaging Het
Abca1 T C 4: 53,092,918 T289A probably benign Het
Adnp A T 2: 168,182,743 S877R probably benign Het
Akap13 T A 7: 75,736,342 H555Q probably benign Het
Alg6 T A 4: 99,726,894 Y38* probably null Het
Amtn C A 5: 88,380,346 Q93K probably benign Het
Ap2b1 T C 11: 83,402,598 V937A probably damaging Het
Arih1 ATCGTCCGGCTCGTCCTCGTCGTCGTCC ATCGTCC 9: 59,486,237 probably benign Het
Bhmt A G 13: 93,621,571 S211P possibly damaging Het
Bmp1 T C 14: 70,477,866 Y943C probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Cbfb A C 8: 105,178,611 T62P probably damaging Het
Ccdc154 T C 17: 25,167,381 F249L probably damaging Het
Cdh26 T A 2: 178,470,190 F514L probably damaging Het
Cdhr2 A G 13: 54,718,537 E352G Het
Cep295nl G A 11: 118,333,940 P26L possibly damaging Het
Cfdp1 A G 8: 111,845,175 V34A probably damaging Het
Cntrl A G 2: 35,160,266 K1464E probably damaging Het
Crybg3 T C 16: 59,506,250 D1039G possibly damaging Het
Csmd3 A T 15: 47,849,720 S778R Het
Daam2 C T 17: 49,473,304 C729Y probably damaging Het
Ddx18 T C 1: 121,561,403 H305R probably damaging Het
Dio1 C T 4: 107,292,361 C248Y probably benign Het
Dnah1 C A 14: 31,294,815 A1582S probably damaging Het
Eef1a1 A T 9: 78,479,350 D319E probably benign Het
Fam171b G A 2: 83,812,765 R6H probably damaging Het
Fam214a A G 9: 75,010,230 N711D possibly damaging Het
Flnb G A 14: 7,926,421 G1822R probably damaging Het
Gabrb1 G A 5: 72,122,020 V303I possibly damaging Het
Gli3 T G 13: 15,726,668 S1547A probably benign Het
Gm4884 A T 7: 41,043,687 N360I possibly damaging Het
Gm9573 T A 17: 35,621,828 T489S unknown Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Ino80 C G 2: 119,450,015 K289N probably damaging Het
Itpr1 G A 6: 108,416,909 E1638K probably damaging Het
Jakmip1 A T 5: 37,117,468 I45F unknown Het
Kif1a G A 1: 93,055,723 P684L probably benign Het
Kpnb1 A T 11: 97,167,634 S610T probably benign Het
Man1a2 A G 3: 100,684,645 V73A probably benign Het
Mbtps1 A G 8: 119,508,882 V1019A possibly damaging Het
Nup210 G C 6: 91,017,393 N1774K probably benign Het
Olfr763 G T 10: 129,011,890 V202F probably benign Het
Pik3c2b T C 1: 133,071,607 S398P probably damaging Het
Pmpca A G 2: 26,389,976 T37A probably benign Het
Ppfia1 A G 7: 144,498,779 S840P probably damaging Het
Prkcq A T 2: 11,256,203 K355N probably benign Het
Ptprg A G 14: 12,237,809 K1422R probably benign Het
Ptprq T C 10: 107,542,662 E2006G probably damaging Het
Qsox1 TG T 1: 155,795,389 probably null Het
Rcor2 A T 19: 7,274,226 T412S probably benign Het
Rnf224 A T 2: 25,236,188 M51K probably benign Het
Robo4 A G 9: 37,406,213 D521G probably damaging Het
Sf3b4 T A 3: 96,176,799 S360T unknown Het
Sgo2b T C 8: 63,927,617 D727G probably damaging Het
Smpd2 C A 10: 41,488,287 V172L probably benign Het
Syne1 C T 10: 5,323,887 A1966T probably benign Het
Syt13 G A 2: 92,915,230 G15D possibly damaging Het
Taf3 A T 2: 9,918,259 L18Q unknown Het
Tcam1 T A 11: 106,285,433 N328K probably damaging Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tet2 A T 3: 133,488,006 Y222* probably null Het
Timm29 A T 9: 21,592,922 probably benign Het
Tmc6 T C 11: 117,779,169 D17G probably benign Het
Tmem30a T A 9: 79,780,644 D81V probably benign Het
Tnnt1 T C 7: 4,508,502 I195V probably benign Het
Ttc30b T C 2: 75,937,800 Y203C probably damaging Het
Ttll5 T A 12: 85,892,122 V398E possibly damaging Het
Ttn T C 2: 76,918,097 T4203A possibly damaging Het
Ubc A G 5: 125,387,447 I272T probably damaging Het
Uhrf1bp1 T A 17: 27,886,779 S760T probably benign Het
Unc45a A G 7: 80,334,037 L337P probably damaging Het
Vmn1r229 T C 17: 20,815,053 F187L probably benign Het
Wrn A T 8: 33,324,273 M381K probably benign Het
Zdbf2 A G 1: 63,303,476 N338S possibly damaging Het
Zfp541 A G 7: 16,071,967 E9G possibly damaging Het
Zrsr1 G A 11: 22,973,418 R64Q possibly damaging Het
Zswim8 T A 14: 20,722,163 S1614T probably benign Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 46015263 missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46988787 missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47193038 missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46484072 missense probably benign
IGL00857:Cntnap2 APN 6 47049424 missense probably benign 0.00
IGL01290:Cntnap2 APN 6 46015465 missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47193013 missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47271371 nonsense probably null
IGL01859:Cntnap2 APN 6 46988721 missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46234203 missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 47021654 missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46234320 missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 47021736 missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47095549 missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46170245 missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46530171 missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46483983 missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45060392 splice site probably null
R0352:Cntnap2 UTSW 6 45992084 splice site probably null
R0389:Cntnap2 UTSW 6 46009637 missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45715816 missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46529905 nonsense probably null
R0611:Cntnap2 UTSW 6 47095549 missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46988760 missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47296708 splice site probably benign
R0976:Cntnap2 UTSW 6 47271230 missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1387:Cntnap2 UTSW 6 47107914 missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46530679 missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 46015330 missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47107892 nonsense probably null
R1757:Cntnap2 UTSW 6 46759829 missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46988675 missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46530633 missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47298588 missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47298445 missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 46015266 missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45991903 missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46856128 missense probably benign
R4030:Cntnap2 UTSW 6 46856128 missense probably benign
R4237:Cntnap2 UTSW 6 46530390 intron probably benign
R4445:Cntnap2 UTSW 6 46759851 missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46530035 intron probably benign
R4918:Cntnap2 UTSW 6 46530035 intron probably benign
R4999:Cntnap2 UTSW 6 45920834 missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45920926 nonsense probably null
R5748:Cntnap2 UTSW 6 45715884 missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46529815 intron probably benign
R6118:Cntnap2 UTSW 6 47193077 missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46759808 missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47271298 missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45060112 splice site probably null
R6385:Cntnap2 UTSW 6 46856180 missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46759760 missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46170272 missense probably benign 0.25
R6610:Cntnap2 UTSW 6 46015257 missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46988646 missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47271271 missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46484029 missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46347145 missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47095693 missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46759773 missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45992041 missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47049222 missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 46001227 missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46856142 missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46484049 missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46484205 intron probably benign
R9209:Cntnap2 UTSW 6 47049249 missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 46001178 missense probably benign 0.00
R9310:Cntnap2 UTSW 6 46001347 missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 46001310 missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46234283 missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 46015231 missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45992075 missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 46015439 frame shift probably null
R9745:Cntnap2 UTSW 6 46234166 missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47049327 missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 47021665 missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 46009518 missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 47021754 missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46234245 missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47271148 missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 46015299 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGTACACAATAACTCGTCTTCTCTC -3'
(R):5'- CAGGCTGGTTTACACACCTCTG -3'

Sequencing Primer
(F):5'- GTCTTCTCTCTTTATCCCACAGG -3'
(R):5'- GCTGGTTTACACACCTCTGACTAC -3'
Posted On 2022-09-12