Incidental Mutation 'R9621:Itpr1'
ID 724788
Institutional Source Beutler Lab
Gene Symbol Itpr1
Ensembl Gene ENSMUSG00000030102
Gene Name inositol 1,4,5-trisphosphate receptor 1
Synonyms P400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Essential gene? Probably essential (E-score: 0.839) question?
Stock # R9621 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 108213096-108551109 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 108416909 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1638 (E1638K)
Ref Sequence ENSEMBL: ENSMUSP00000032192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203262] [ENSMUST00000203615]
AlphaFold no structure available at present
PDB Structure Crystal structure of the inositol 1,4,5-trisphosphate receptor binding core in complex with IP3 [X-RAY DIFFRACTION]
Crystal structure of the ligand binding suppressor domain of type 1 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000032192
AA Change: E1638K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: E1638K

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1758 1787 N/A INTRINSIC
Pfam:RIH_assoc 1959 2069 1.2e-33 PFAM
transmembrane domain 2274 2296 N/A INTRINSIC
Pfam:Ion_trans 2311 2600 9e-22 PFAM
coiled coil region 2683 2732 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203262
AA Change: E36K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145177
Gene: ENSMUSG00000030102
AA Change: E36K

DomainStartEndE-ValueType
low complexity region 144 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203615
AA Change: E1638K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: E1638K

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1757 1786 N/A INTRINSIC
Pfam:RIH_assoc 1958 2068 1.2e-33 PFAM
transmembrane domain 2273 2295 N/A INTRINSIC
Pfam:Ion_trans 2310 2599 9e-22 PFAM
coiled coil region 2682 2731 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000203687
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]
Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik C A 12: 55,382,257 H538N probably benign Het
2410131K14Rik C T 5: 118,255,815 T86I possibly damaging Het
Abca1 T C 4: 53,092,918 T289A probably benign Het
Adnp A T 2: 168,182,743 S877R probably benign Het
Akap13 T A 7: 75,736,342 H555Q probably benign Het
Alg6 T A 4: 99,726,894 Y38* probably null Het
Amtn C A 5: 88,380,346 Q93K probably benign Het
Ap2b1 T C 11: 83,402,598 V937A probably damaging Het
Arih1 ATCGTCCGGCTCGTCCTCGTCGTCGTCC ATCGTCC 9: 59,486,237 probably benign Het
Bhmt A G 13: 93,621,571 S211P possibly damaging Het
Bmp1 T C 14: 70,477,866 Y943C probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Cbfb A C 8: 105,178,611 T62P probably damaging Het
Ccdc154 T C 17: 25,167,381 F249L probably damaging Het
Cdh26 T A 2: 178,470,190 F514L probably damaging Het
Cdhr2 A G 13: 54,718,537 E352G Het
Cep295nl G A 11: 118,333,940 P26L possibly damaging Het
Cfdp1 A G 8: 111,845,175 V34A probably damaging Het
Cntnap2 A T 6: 46,988,792 I846F probably damaging Het
Cntrl A G 2: 35,160,266 K1464E probably damaging Het
Crybg3 T C 16: 59,506,250 D1039G possibly damaging Het
Csmd3 A T 15: 47,849,720 S778R Het
Daam2 C T 17: 49,473,304 C729Y probably damaging Het
Ddx18 T C 1: 121,561,403 H305R probably damaging Het
Dio1 C T 4: 107,292,361 C248Y probably benign Het
Dnah1 C A 14: 31,294,815 A1582S probably damaging Het
Eef1a1 A T 9: 78,479,350 D319E probably benign Het
Fam171b G A 2: 83,812,765 R6H probably damaging Het
Fam214a A G 9: 75,010,230 N711D possibly damaging Het
Flnb G A 14: 7,926,421 G1822R probably damaging Het
Gabrb1 G A 5: 72,122,020 V303I possibly damaging Het
Gli3 T G 13: 15,726,668 S1547A probably benign Het
Gm4884 A T 7: 41,043,687 N360I possibly damaging Het
Gm9573 T A 17: 35,621,828 T489S unknown Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Ino80 C G 2: 119,450,015 K289N probably damaging Het
Jakmip1 A T 5: 37,117,468 I45F unknown Het
Kif1a G A 1: 93,055,723 P684L probably benign Het
Kpnb1 A T 11: 97,167,634 S610T probably benign Het
Man1a2 A G 3: 100,684,645 V73A probably benign Het
Mbtps1 A G 8: 119,508,882 V1019A possibly damaging Het
Nup210 G C 6: 91,017,393 N1774K probably benign Het
Olfr763 G T 10: 129,011,890 V202F probably benign Het
Pik3c2b T C 1: 133,071,607 S398P probably damaging Het
Pmpca A G 2: 26,389,976 T37A probably benign Het
Ppfia1 A G 7: 144,498,779 S840P probably damaging Het
Prkcq A T 2: 11,256,203 K355N probably benign Het
Ptprg A G 14: 12,237,809 K1422R probably benign Het
Ptprq T C 10: 107,542,662 E2006G probably damaging Het
Qsox1 TG T 1: 155,795,389 probably null Het
Rcor2 A T 19: 7,274,226 T412S probably benign Het
Rnf224 A T 2: 25,236,188 M51K probably benign Het
Robo4 A G 9: 37,406,213 D521G probably damaging Het
Sf3b4 T A 3: 96,176,799 S360T unknown Het
Sgo2b T C 8: 63,927,617 D727G probably damaging Het
Smpd2 C A 10: 41,488,287 V172L probably benign Het
Syne1 C T 10: 5,323,887 A1966T probably benign Het
Syt13 G A 2: 92,915,230 G15D possibly damaging Het
Taf3 A T 2: 9,918,259 L18Q unknown Het
Tcam1 T A 11: 106,285,433 N328K probably damaging Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tet2 A T 3: 133,488,006 Y222* probably null Het
Timm29 A T 9: 21,592,922 probably benign Het
Tmc6 T C 11: 117,779,169 D17G probably benign Het
Tmem30a T A 9: 79,780,644 D81V probably benign Het
Tnnt1 T C 7: 4,508,502 I195V probably benign Het
Ttc30b T C 2: 75,937,800 Y203C probably damaging Het
Ttll5 T A 12: 85,892,122 V398E possibly damaging Het
Ttn T C 2: 76,918,097 T4203A possibly damaging Het
Ubc A G 5: 125,387,447 I272T probably damaging Het
Uhrf1bp1 T A 17: 27,886,779 S760T probably benign Het
Unc45a A G 7: 80,334,037 L337P probably damaging Het
Vmn1r229 T C 17: 20,815,053 F187L probably benign Het
Wrn A T 8: 33,324,273 M381K probably benign Het
Zdbf2 A G 1: 63,303,476 N338S possibly damaging Het
Zfp541 A G 7: 16,071,967 E9G possibly damaging Het
Zrsr1 G A 11: 22,973,418 R64Q possibly damaging Het
Zswim8 T A 14: 20,722,163 S1614T probably benign Het
Other mutations in Itpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Itpr1 APN 6 108471120 missense probably damaging 0.98
IGL01073:Itpr1 APN 6 108413820 missense probably benign 0.00
IGL01105:Itpr1 APN 6 108381333 missense probably benign 0.00
IGL01296:Itpr1 APN 6 108399361 missense probably damaging 1.00
IGL01325:Itpr1 APN 6 108381208 missense probably benign 0.01
IGL01418:Itpr1 APN 6 108339624 critical splice donor site probably null
IGL01464:Itpr1 APN 6 108386727 missense possibly damaging 0.95
IGL01467:Itpr1 APN 6 108488496 missense probably damaging 0.96
IGL01645:Itpr1 APN 6 108473599 missense possibly damaging 0.91
IGL01672:Itpr1 APN 6 108381032 nonsense probably null
IGL01969:Itpr1 APN 6 108377691 missense probably damaging 1.00
IGL02164:Itpr1 APN 6 108389483 missense probably benign 0.08
IGL02206:Itpr1 APN 6 108549820 missense probably damaging 1.00
IGL02232:Itpr1 APN 6 108417923 missense probably damaging 1.00
IGL02297:Itpr1 APN 6 108339517 missense possibly damaging 0.84
IGL02434:Itpr1 APN 6 108489922 splice site probably null
IGL02568:Itpr1 APN 6 108339554 missense possibly damaging 0.82
IGL02992:Itpr1 APN 6 108381315 missense probably damaging 1.00
IGL03109:Itpr1 APN 6 108417981 missense probably damaging 1.00
IGL03130:Itpr1 APN 6 108523401 missense probably benign 0.00
IGL03333:Itpr1 APN 6 108380910 unclassified probably benign
aboriginal UTSW 6 108515947 missense probably benign
approximation UTSW 6 108394841 missense probably benign
estimate UTSW 6 108389553 missense probably null 1.00
icarus UTSW 6 108410900 missense probably damaging 1.00
marsupialized UTSW 6 108394073 splice site probably null
primordial UTSW 6 108518755 missense probably benign 0.06
roo UTSW 6 108410867 missense probably benign 0.00
wallaby UTSW 6 108389387 missense probably damaging 1.00
P0005:Itpr1 UTSW 6 108381257 missense probably damaging 1.00
PIT4366001:Itpr1 UTSW 6 108493757 nonsense probably null
R0019:Itpr1 UTSW 6 108354626 missense probably damaging 1.00
R0128:Itpr1 UTSW 6 108471209 splice site probably benign
R0129:Itpr1 UTSW 6 108349676 missense probably damaging 1.00
R0135:Itpr1 UTSW 6 108488482 splice site probably benign
R0244:Itpr1 UTSW 6 108473589 missense probably benign 0.00
R0391:Itpr1 UTSW 6 108378167 missense probably benign 0.22
R0543:Itpr1 UTSW 6 108515748 splice site probably benign
R0647:Itpr1 UTSW 6 108383698 missense probably damaging 1.00
R0766:Itpr1 UTSW 6 108410900 missense probably damaging 1.00
R0971:Itpr1 UTSW 6 108349629 missense possibly damaging 0.70
R1083:Itpr1 UTSW 6 108510696 missense possibly damaging 0.92
R1277:Itpr1 UTSW 6 108339621 missense probably benign 0.22
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1605:Itpr1 UTSW 6 108349659 missense possibly damaging 0.77
R1661:Itpr1 UTSW 6 108482897 missense probably benign 0.38
R1852:Itpr1 UTSW 6 108386706 missense probably damaging 1.00
R1929:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2012:Itpr1 UTSW 6 108440536 missense probably benign 0.02
R2027:Itpr1 UTSW 6 108386853 missense possibly damaging 0.80
R2111:Itpr1 UTSW 6 108378309 unclassified probably benign
R2166:Itpr1 UTSW 6 108388225 missense probably damaging 1.00
R2272:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2484:Itpr1 UTSW 6 108369110 missense probably damaging 1.00
R3115:Itpr1 UTSW 6 108406109 missense possibly damaging 0.55
R3751:Itpr1 UTSW 6 108349680 missense probably damaging 1.00
R3798:Itpr1 UTSW 6 108381270 missense probably damaging 1.00
R3930:Itpr1 UTSW 6 108394841 missense probably benign
R4081:Itpr1 UTSW 6 108391835 missense probably damaging 1.00
R4119:Itpr1 UTSW 6 108394355 missense probably benign
R4406:Itpr1 UTSW 6 108354663 missense probably damaging 1.00
R4506:Itpr1 UTSW 6 108432686 missense probably damaging 1.00
R4616:Itpr1 UTSW 6 108481223 missense probably damaging 1.00
R4655:Itpr1 UTSW 6 108481293 missense probably damaging 1.00
R4661:Itpr1 UTSW 6 108410931 critical splice donor site probably null
R4760:Itpr1 UTSW 6 108349632 missense probably benign 0.29
R4836:Itpr1 UTSW 6 108389537 missense probably damaging 0.99
R4857:Itpr1 UTSW 6 108410867 missense probably benign 0.00
R4876:Itpr1 UTSW 6 108482906 missense probably damaging 0.97
R4939:Itpr1 UTSW 6 108440558 nonsense probably null
R5076:Itpr1 UTSW 6 108405529 splice site probably null
R5088:Itpr1 UTSW 6 108389387 missense probably damaging 1.00
R5248:Itpr1 UTSW 6 108542062 missense probably damaging 1.00
R5290:Itpr1 UTSW 6 108406145 missense possibly damaging 0.95
R5308:Itpr1 UTSW 6 108356511 missense probably damaging 1.00
R5339:Itpr1 UTSW 6 108393961 missense probably damaging 1.00
R5368:Itpr1 UTSW 6 108387498 missense probably damaging 1.00
R5369:Itpr1 UTSW 6 108519424 missense probably damaging 0.99
R5419:Itpr1 UTSW 6 108493794 missense possibly damaging 0.95
R5615:Itpr1 UTSW 6 108488600 missense possibly damaging 0.71
R5779:Itpr1 UTSW 6 108352143 missense probably damaging 1.00
R5781:Itpr1 UTSW 6 108510738 missense probably benign 0.23
R5869:Itpr1 UTSW 6 108473529 missense probably benign 0.30
R5903:Itpr1 UTSW 6 108489797 intron probably benign
R5929:Itpr1 UTSW 6 108423336 missense probably benign
R5956:Itpr1 UTSW 6 108506027 missense probably benign 0.25
R6160:Itpr1 UTSW 6 108518755 missense probably benign 0.06
R6163:Itpr1 UTSW 6 108388284 missense probably damaging 1.00
R6169:Itpr1 UTSW 6 108369116 missense probably damaging 1.00
R6237:Itpr1 UTSW 6 108378203 missense possibly damaging 0.53
R6398:Itpr1 UTSW 6 108505903 missense probably damaging 0.96
R6455:Itpr1 UTSW 6 108417972 missense probably damaging 1.00
R6522:Itpr1 UTSW 6 108388276 missense probably damaging 1.00
R6524:Itpr1 UTSW 6 108363683 missense probably damaging 1.00
R6650:Itpr1 UTSW 6 108394073 splice site probably null
R6806:Itpr1 UTSW 6 108515947 missense probably benign
R6838:Itpr1 UTSW 6 108471191 missense possibly damaging 0.87
R6841:Itpr1 UTSW 6 108388192 missense probably damaging 1.00
R6896:Itpr1 UTSW 6 108481394 missense probably damaging 1.00
R7014:Itpr1 UTSW 6 108431498 critical splice donor site probably null
R7076:Itpr1 UTSW 6 108388296 missense probably benign
R7116:Itpr1 UTSW 6 108481268 missense probably damaging 0.99
R7152:Itpr1 UTSW 6 108394407 critical splice donor site probably null
R7161:Itpr1 UTSW 6 108386640 missense probably damaging 1.00
R7166:Itpr1 UTSW 6 108378190 missense probably benign 0.06
R7241:Itpr1 UTSW 6 108517620 critical splice donor site probably null
R7301:Itpr1 UTSW 6 108542024 missense possibly damaging 0.86
R7330:Itpr1 UTSW 6 108438331 missense probably benign 0.28
R7449:Itpr1 UTSW 6 108389384 missense probably damaging 0.98
R7472:Itpr1 UTSW 6 108403396 missense probably benign 0.05
R7502:Itpr1 UTSW 6 108383678 missense probably benign 0.00
R7779:Itpr1 UTSW 6 108523348 missense possibly damaging 0.75
R7828:Itpr1 UTSW 6 108482931 missense probably damaging 1.00
R7854:Itpr1 UTSW 6 108387369 missense probably damaging 1.00
R7974:Itpr1 UTSW 6 108523405 missense possibly damaging 0.86
R7998:Itpr1 UTSW 6 108417948 missense possibly damaging 0.88
R8039:Itpr1 UTSW 6 108386628 missense probably damaging 1.00
R8136:Itpr1 UTSW 6 108438360 missense probably benign 0.18
R8200:Itpr1 UTSW 6 108394865 missense probably benign 0.00
R8242:Itpr1 UTSW 6 108386697 missense probably benign 0.44
R8322:Itpr1 UTSW 6 108388229 missense probably benign 0.05
R8377:Itpr1 UTSW 6 108510738 missense probably benign 0.00
R8412:Itpr1 UTSW 6 108363620 missense probably benign 0.07
R8443:Itpr1 UTSW 6 108519348 missense probably damaging 0.99
R8669:Itpr1 UTSW 6 108393967 missense probably damaging 0.99
R8697:Itpr1 UTSW 6 108523366 missense probably damaging 1.00
R8744:Itpr1 UTSW 6 108377802 missense possibly damaging 0.79
R8870:Itpr1 UTSW 6 108388211 missense probably damaging 1.00
R8921:Itpr1 UTSW 6 108378198 missense possibly damaging 0.87
R8961:Itpr1 UTSW 6 108493705 missense possibly damaging 0.86
R9095:Itpr1 UTSW 6 108387391 missense probably benign 0.02
R9205:Itpr1 UTSW 6 108489849 missense probably damaging 0.99
R9282:Itpr1 UTSW 6 108394023 missense probably damaging 1.00
R9323:Itpr1 UTSW 6 108352018 missense probably damaging 1.00
R9376:Itpr1 UTSW 6 108349677 missense probably damaging 0.99
R9392:Itpr1 UTSW 6 108413876 missense probably benign
R9428:Itpr1 UTSW 6 108401347 missense possibly damaging 0.84
R9632:Itpr1 UTSW 6 108405520 missense possibly damaging 0.50
R9646:Itpr1 UTSW 6 108394884 missense probably damaging 1.00
R9695:Itpr1 UTSW 6 108401350 missense probably damaging 1.00
R9710:Itpr1 UTSW 6 108405520 missense possibly damaging 0.50
R9721:Itpr1 UTSW 6 108406102 missense probably damaging 0.96
R9780:Itpr1 UTSW 6 108510834 missense probably benign 0.03
Z1176:Itpr1 UTSW 6 108499149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGATAGGTAGAGGCTCATCC -3'
(R):5'- AAAGGGCATGCGGTTCAAAC -3'

Sequencing Primer
(F):5'- AGGCTCATCCTATTCCAGCCAG -3'
(R):5'- TGGTCAGAAACAGGACTCTAGTATC -3'
Posted On 2022-09-12