Incidental Mutation 'R0762:Rab44'
ID72479
Institutional Source Beutler Lab
Gene Symbol Rab44
Ensembl Gene ENSMUSG00000064147
Gene NameRAB44, member RAS oncogene family
Synonyms9830134C10Rik
MMRRC Submission 038942-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0762 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location29135056-29148980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29145270 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 606 (L606P)
Ref Sequence ENSEMBL: ENSMUSP00000085253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087942]
Predicted Effect unknown
Transcript: ENSMUST00000087942
AA Change: L606P
SMART Domains Protein: ENSMUSP00000085253
Gene: ENSMUSG00000064147
AA Change: L606P

DomainStartEndE-ValueType
coiled coil region 1 68 N/A INTRINSIC
low complexity region 143 157 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
RAB 538 701 1.11e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139931
Meta Mutation Damage Score 0.1455 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 93.9%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,218,416 probably benign Het
4921504E06Rik T A 2: 19,477,856 N475I probably damaging Het
Adar T C 3: 89,739,983 probably benign Het
Aldh3b3 A T 19: 3,965,747 probably null Het
Amtn C T 5: 88,385,000 T158I possibly damaging Het
Ap1g2 A G 14: 55,100,411 probably benign Het
Arhgef3 A G 14: 27,397,627 Y318C probably damaging Het
Atg2b A C 12: 105,674,970 V69G possibly damaging Het
Bbx G A 16: 50,225,166 T236I possibly damaging Het
Bcl11b C T 12: 107,965,663 probably benign Het
Catsperg1 T C 7: 29,189,952 I794V probably benign Het
Ccdc88a C T 11: 29,463,112 probably benign Het
Cdhr3 C A 12: 33,060,301 R328L probably benign Het
Ces2e T A 8: 104,929,864 M242K probably damaging Het
Col12a1 A G 9: 79,681,374 probably benign Het
Col3a1 T C 1: 45,321,526 S39P unknown Het
Cyp2a5 T A 7: 26,838,873 Y220* probably null Het
D3Ertd254e G A 3: 36,165,867 D680N possibly damaging Het
Dcc T A 18: 71,342,705 probably benign Het
Dnajb8 A G 6: 88,223,054 T191A probably damaging Het
Ephx2 A T 14: 66,102,179 F199I probably damaging Het
Fancd2 A G 6: 113,574,658 K1062E probably benign Het
Fbxo33 A G 12: 59,204,499 V410A probably benign Het
Gars T G 6: 55,077,580 probably null Het
Git1 A C 11: 77,499,834 D132A possibly damaging Het
Gm853 A G 4: 130,221,624 S44P probably damaging Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Gucy1a1 T C 3: 82,094,896 T44A unknown Het
Hjurp G C 1: 88,277,215 probably benign Het
Ifnlr1 A G 4: 135,701,329 K156E possibly damaging Het
Klf13 T C 7: 63,891,623 N15S probably benign Het
Krt77 T C 15: 101,861,126 probably null Het
Map4 C A 9: 110,038,478 probably benign Het
Mthfr T C 4: 148,055,443 I623T possibly damaging Het
Myo7b T A 18: 31,983,944 T908S probably benign Het
Nbeal2 T G 9: 110,643,808 probably benign Het
Nwd2 T G 5: 63,800,414 F362L probably benign Het
Pcm1 A T 8: 41,261,020 R208W probably damaging Het
Pkd2l1 T C 19: 44,150,470 D647G probably benign Het
Plbd1 C T 6: 136,641,147 V24M probably damaging Het
Polr2a G A 11: 69,735,117 P1698S unknown Het
Prss12 T C 3: 123,485,504 I410T probably damaging Het
Ptpre A G 7: 135,679,235 N565S probably damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Rhd C T 4: 134,876,301 probably benign Het
Rspo3 T A 10: 29,499,921 probably benign Het
Sdccag8 T A 1: 176,946,144 N555K probably benign Het
Skint6 T A 4: 112,865,651 probably benign Het
Slc22a20 G A 19: 5,986,008 P45S probably damaging Het
Slc5a2 A G 7: 128,267,482 Y124C probably damaging Het
Spats2l T C 1: 57,885,884 L127P possibly damaging Het
Taar8a T A 10: 24,077,077 I193N probably benign Het
Ten1 C T 11: 116,216,684 probably benign Het
Tfb2m T C 1: 179,545,833 E100G probably damaging Het
Tom1 C T 8: 75,052,306 probably benign Het
Vps52 G T 17: 33,960,011 R171L probably damaging Het
Zcwpw2 A T 9: 118,014,114 noncoding transcript Het
Zfhx4 G A 3: 5,403,820 E3013K probably damaging Het
Zfp777 C T 6: 48,029,360 V411M probably damaging Het
Other mutations in Rab44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Rab44 APN 17 29139737 missense probably benign
IGL01545:Rab44 APN 17 29147377 missense unknown
IGL02314:Rab44 APN 17 29139353 missense probably benign 0.04
IGL02402:Rab44 APN 17 29140516 missense probably benign 0.01
IGL02492:Rab44 APN 17 29146049 splice site probably benign
R0018:Rab44 UTSW 17 29139380 missense probably benign 0.03
R0135:Rab44 UTSW 17 29138132 missense probably benign 0.01
R0193:Rab44 UTSW 17 29140307 missense probably benign
R0398:Rab44 UTSW 17 29145370 splice site probably benign
R0403:Rab44 UTSW 17 29145261 missense probably damaging 1.00
R0608:Rab44 UTSW 17 29147343 splice site probably null
R0631:Rab44 UTSW 17 29139144 missense possibly damaging 0.91
R1128:Rab44 UTSW 17 29140461 missense possibly damaging 0.90
R1681:Rab44 UTSW 17 29140124 missense possibly damaging 0.47
R1706:Rab44 UTSW 17 29138106 missense probably damaging 1.00
R2679:Rab44 UTSW 17 29144477 splice site probably null
R3500:Rab44 UTSW 17 29138067 missense probably benign 0.09
R3709:Rab44 UTSW 17 29139869 missense probably benign 0.08
R4497:Rab44 UTSW 17 29139897 missense probably benign 0.04
R4655:Rab44 UTSW 17 29139194 missense probably benign
R4833:Rab44 UTSW 17 29136337 missense probably damaging 1.00
R4850:Rab44 UTSW 17 29140089 missense possibly damaging 0.95
R4926:Rab44 UTSW 17 29139555 missense probably benign 0.01
R5694:Rab44 UTSW 17 29140500 missense probably damaging 1.00
R5694:Rab44 UTSW 17 29145966 missense unknown
R5835:Rab44 UTSW 17 29148238 missense probably benign 0.13
R6146:Rab44 UTSW 17 29135417 start gained probably benign
R6629:Rab44 UTSW 17 29135780 start gained probably benign
R6814:Rab44 UTSW 17 29139810 missense probably benign 0.18
R6865:Rab44 UTSW 17 29139227 missense probably benign
R6872:Rab44 UTSW 17 29139810 missense probably benign 0.18
R7032:Rab44 UTSW 17 29140464 missense unknown
R7058:Rab44 UTSW 17 29138176 splice site probably null
R7207:Rab44 UTSW 17 29138039 nonsense probably null
R7218:Rab44 UTSW 17 29139444 missense
R7418:Rab44 UTSW 17 29140496 missense unknown
R7651:Rab44 UTSW 17 29148205 missense unknown
Predicted Primers PCR Primer
(F):5'- ACATGGGAGATGCCCTAAGTGACC -3'
(R):5'- GGAAGCCTTTCTGGATTGTTCTGCC -3'

Sequencing Primer
(F):5'- GATGCCCTAAGTGACCCCTAAATAC -3'
(R):5'- gctgagctgtctctctagcc -3'
Posted On2013-09-30