Incidental Mutation 'R9621:Gli3'
ID 724819
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene Name GLI-Kruppel family member GLI3
Synonyms Bph, brachyphalangy
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9621 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 15638308-15904611 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 15901253 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 1547 (S1547A)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510]
AlphaFold Q61602
Predicted Effect probably benign
Transcript: ENSMUST00000110510
AA Change: S1547A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: S1547A

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,092,918 (GRCm39) T289A probably benign Het
Adnp A T 2: 168,024,663 (GRCm39) S877R probably benign Het
Akap13 T A 7: 75,386,090 (GRCm39) H555Q probably benign Het
Alg6 T A 4: 99,615,131 (GRCm39) Y38* probably null Het
Amtn C A 5: 88,528,205 (GRCm39) Q93K probably benign Het
Ap2b1 T C 11: 83,293,424 (GRCm39) V937A probably damaging Het
Arih1 ATCGTCCGGCTCGTCCTCGTCGTCGTCC ATCGTCC 9: 59,393,520 (GRCm39) probably benign Het
Atosa A G 9: 74,917,512 (GRCm39) N711D possibly damaging Het
Bhmt A G 13: 93,758,079 (GRCm39) S211P possibly damaging Het
Bltp3a T A 17: 28,105,753 (GRCm39) S760T probably benign Het
Bmp1 T C 14: 70,715,306 (GRCm39) Y943C probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 95,990,862 (GRCm39) probably null Het
Cbfb A C 8: 105,905,243 (GRCm39) T62P probably damaging Het
Ccdc154 T C 17: 25,386,355 (GRCm39) F249L probably damaging Het
Cdh26 T A 2: 178,111,983 (GRCm39) F514L probably damaging Het
Cdhr2 A G 13: 54,866,350 (GRCm39) E352G Het
Cep295nl G A 11: 118,224,766 (GRCm39) P26L possibly damaging Het
Cfdp1 A G 8: 112,571,807 (GRCm39) V34A probably damaging Het
Cntnap2 A T 6: 46,965,726 (GRCm39) I846F probably damaging Het
Cntrl A G 2: 35,050,278 (GRCm39) K1464E probably damaging Het
Crybg3 T C 16: 59,326,613 (GRCm39) D1039G possibly damaging Het
Csmd3 A T 15: 47,713,116 (GRCm39) S778R Het
Daam2 C T 17: 49,780,332 (GRCm39) C729Y probably damaging Het
Ddx18 T C 1: 121,489,132 (GRCm39) H305R probably damaging Het
Dio1 C T 4: 107,149,558 (GRCm39) C248Y probably benign Het
Dnah1 C A 14: 31,016,772 (GRCm39) A1582S probably damaging Het
Eef1a1 A T 9: 78,386,632 (GRCm39) D319E probably benign Het
Fam171b G A 2: 83,643,109 (GRCm39) R6H probably damaging Het
Flnb G A 14: 7,926,421 (GRCm38) G1822R probably damaging Het
Gabrb1 G A 5: 72,279,363 (GRCm39) V303I possibly damaging Het
Gm4884 A T 7: 40,693,111 (GRCm39) N360I possibly damaging Het
Ift70b T C 2: 75,768,144 (GRCm39) Y203C probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,366,470 (GRCm39) probably benign Het
Ino80 C G 2: 119,280,496 (GRCm39) K289N probably damaging Het
Itpr1 G A 6: 108,393,870 (GRCm39) E1638K probably damaging Het
Jakmip1 A T 5: 37,274,812 (GRCm39) I45F unknown Het
Kif1a G A 1: 92,983,445 (GRCm39) P684L probably benign Het
Kpnb1 A T 11: 97,058,460 (GRCm39) S610T probably benign Het
Man1a2 A G 3: 100,591,961 (GRCm39) V73A probably benign Het
Mbtps1 A G 8: 120,235,621 (GRCm39) V1019A possibly damaging Het
Muc21 T A 17: 35,932,720 (GRCm39) T489S unknown Het
Nup210 G C 6: 90,994,375 (GRCm39) N1774K probably benign Het
Or10p21 G T 10: 128,847,759 (GRCm39) V202F probably benign Het
Pik3c2b T C 1: 132,999,345 (GRCm39) S398P probably damaging Het
Pmpca A G 2: 26,279,988 (GRCm39) T37A probably benign Het
Ppfia1 A G 7: 144,052,516 (GRCm39) S840P probably damaging Het
Prkcq A T 2: 11,261,014 (GRCm39) K355N probably benign Het
Prorp C A 12: 55,429,042 (GRCm39) H538N probably benign Het
Ptprg A G 14: 12,237,809 (GRCm38) K1422R probably benign Het
Ptprq T C 10: 107,378,523 (GRCm39) E2006G probably damaging Het
Qsox1 TG T 1: 155,671,135 (GRCm39) probably null Het
Rcor2 A T 19: 7,251,591 (GRCm39) T412S probably benign Het
Rnf224 A T 2: 25,126,200 (GRCm39) M51K probably benign Het
Robo4 A G 9: 37,317,509 (GRCm39) D521G probably damaging Het
Sf3b4 T A 3: 96,084,115 (GRCm39) S360T unknown Het
Sgo2b T C 8: 64,380,651 (GRCm39) D727G probably damaging Het
Smpd2 C A 10: 41,364,283 (GRCm39) V172L probably benign Het
Spring1 C T 5: 118,393,880 (GRCm39) T86I possibly damaging Het
Syne1 C T 10: 5,273,887 (GRCm39) A1966T probably benign Het
Syt13 G A 2: 92,745,575 (GRCm39) G15D possibly damaging Het
Taf3 A T 2: 9,923,070 (GRCm39) L18Q unknown Het
Tcam1 T A 11: 106,176,259 (GRCm39) N328K probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tet2 A T 3: 133,193,767 (GRCm39) Y222* probably null Het
Timm29 A T 9: 21,504,218 (GRCm39) probably benign Het
Tmc6 T C 11: 117,669,995 (GRCm39) D17G probably benign Het
Tmem30a T A 9: 79,687,926 (GRCm39) D81V probably benign Het
Tnnt1 T C 7: 4,511,501 (GRCm39) I195V probably benign Het
Ttll5 T A 12: 85,938,896 (GRCm39) V398E possibly damaging Het
Ttn T C 2: 76,748,441 (GRCm39) T4203A possibly damaging Het
Ubc A G 5: 125,464,511 (GRCm39) I272T probably damaging Het
Unc45a A G 7: 79,983,785 (GRCm39) L337P probably damaging Het
Vmn1r229 T C 17: 21,035,315 (GRCm39) F187L probably benign Het
Wrn A T 8: 33,814,301 (GRCm39) M381K probably benign Het
Zdbf2 A G 1: 63,342,635 (GRCm39) N338S possibly damaging Het
Zfp541 A G 7: 15,805,892 (GRCm39) E9G possibly damaging Het
Zrsr2-ps1 G A 11: 22,923,418 (GRCm39) R64Q possibly damaging Het
Zswim8 T A 14: 20,772,231 (GRCm39) S1614T probably benign Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15,818,884 (GRCm39) missense probably damaging 1.00
IGL00471:Gli3 APN 13 15,898,354 (GRCm39) critical splice donor site probably null
IGL00484:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15,722,983 (GRCm39) critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15,823,219 (GRCm39) missense probably damaging 1.00
IGL01799:Gli3 APN 13 15,900,746 (GRCm39) missense probably benign 0.00
IGL01861:Gli3 APN 13 15,899,910 (GRCm39) missense probably damaging 1.00
IGL02063:Gli3 APN 13 15,900,957 (GRCm39) missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15,837,099 (GRCm39) missense probably damaging 1.00
IGL02255:Gli3 APN 13 15,823,304 (GRCm39) missense probably damaging 1.00
IGL02270:Gli3 APN 13 15,901,371 (GRCm39) utr 3 prime probably benign
IGL02336:Gli3 APN 13 15,894,874 (GRCm39) missense probably damaging 1.00
IGL02346:Gli3 APN 13 15,898,278 (GRCm39) missense probably damaging 1.00
IGL02744:Gli3 APN 13 15,788,471 (GRCm39) critical splice donor site probably null
IGL02877:Gli3 APN 13 15,899,327 (GRCm39) missense probably damaging 1.00
IGL02975:Gli3 APN 13 15,899,153 (GRCm39) missense probably damaging 1.00
IGL03018:Gli3 APN 13 15,834,717 (GRCm39) missense probably damaging 1.00
IGL03378:Gli3 APN 13 15,819,005 (GRCm39) missense probably damaging 1.00
IGL03406:Gli3 APN 13 15,823,166 (GRCm39) missense probably damaging 1.00
Capone UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
Carpals UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
Ness UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15,818,942 (GRCm39) missense probably damaging 1.00
R0110:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0329:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0330:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0360:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0364:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0469:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0616:Gli3 UTSW 13 15,836,991 (GRCm39) missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15,899,300 (GRCm39) missense probably damaging 1.00
R1072:Gli3 UTSW 13 15,888,190 (GRCm39) missense probably damaging 1.00
R1257:Gli3 UTSW 13 15,900,581 (GRCm39) nonsense probably null
R1270:Gli3 UTSW 13 15,898,329 (GRCm39) missense probably benign 0.02
R1424:Gli3 UTSW 13 15,900,899 (GRCm39) missense probably benign 0.00
R1481:Gli3 UTSW 13 15,788,435 (GRCm39) missense probably damaging 0.99
R1596:Gli3 UTSW 13 15,900,056 (GRCm39) missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15,900,897 (GRCm39) missense probably benign 0.00
R1721:Gli3 UTSW 13 15,900,882 (GRCm39) missense probably benign 0.27
R1797:Gli3 UTSW 13 15,888,097 (GRCm39) missense probably damaging 0.99
R1813:Gli3 UTSW 13 15,823,276 (GRCm39) missense probably damaging 1.00
R1819:Gli3 UTSW 13 15,900,377 (GRCm39) nonsense probably null
R1988:Gli3 UTSW 13 15,900,965 (GRCm39) missense probably benign
R2132:Gli3 UTSW 13 15,900,134 (GRCm39) missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15,836,977 (GRCm39) missense probably benign 0.02
R3085:Gli3 UTSW 13 15,835,526 (GRCm39) missense probably damaging 1.00
R3177:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R3277:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R4162:Gli3 UTSW 13 15,899,700 (GRCm39) missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15,898,156 (GRCm39) missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15,888,216 (GRCm39) missense probably damaging 1.00
R4979:Gli3 UTSW 13 15,899,049 (GRCm39) missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15,723,092 (GRCm39) missense probably damaging 0.99
R5395:Gli3 UTSW 13 15,889,535 (GRCm39) missense probably damaging 1.00
R5494:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R5609:Gli3 UTSW 13 15,723,038 (GRCm39) missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15,652,750 (GRCm39) critical splice donor site probably null
R5810:Gli3 UTSW 13 15,818,894 (GRCm39) missense probably damaging 0.99
R5896:Gli3 UTSW 13 15,900,765 (GRCm39) missense probably benign 0.00
R5930:Gli3 UTSW 13 15,723,210 (GRCm39) missense probably damaging 1.00
R5964:Gli3 UTSW 13 15,900,747 (GRCm39) nonsense probably null
R5985:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6224:Gli3 UTSW 13 15,899,730 (GRCm39) missense probably benign
R6278:Gli3 UTSW 13 15,899,698 (GRCm39) missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15,899,317 (GRCm39) missense probably damaging 1.00
R6383:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6523:Gli3 UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
R7072:Gli3 UTSW 13 15,900,280 (GRCm39) missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15,889,647 (GRCm39) missense probably damaging 1.00
R7228:Gli3 UTSW 13 15,899,087 (GRCm39) missense probably benign 0.00
R7327:Gli3 UTSW 13 15,900,144 (GRCm39) missense probably benign 0.02
R7451:Gli3 UTSW 13 15,900,876 (GRCm39) missense possibly damaging 0.50
R7974:Gli3 UTSW 13 15,900,841 (GRCm39) missense probably benign 0.00
R8167:Gli3 UTSW 13 15,900,228 (GRCm39) missense probably benign 0.00
R8170:Gli3 UTSW 13 15,894,793 (GRCm39) missense probably benign
R8199:Gli3 UTSW 13 15,900,576 (GRCm39) missense probably benign 0.08
R8247:Gli3 UTSW 13 15,901,360 (GRCm39) missense possibly damaging 0.82
R8332:Gli3 UTSW 13 15,888,133 (GRCm39) missense possibly damaging 0.58
R8347:Gli3 UTSW 13 15,898,110 (GRCm39) missense probably damaging 1.00
R8559:Gli3 UTSW 13 15,834,717 (GRCm39) missense probably damaging 1.00
R8676:Gli3 UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
R8905:Gli3 UTSW 13 15,901,116 (GRCm39) missense probably benign 0.01
R9099:Gli3 UTSW 13 15,901,320 (GRCm39) missense probably damaging 1.00
R9260:Gli3 UTSW 13 15,899,675 (GRCm39) missense probably damaging 0.99
R9317:Gli3 UTSW 13 15,889,658 (GRCm39) missense probably damaging 1.00
R9475:Gli3 UTSW 13 15,900,296 (GRCm39) missense possibly damaging 0.87
R9546:Gli3 UTSW 13 15,788,443 (GRCm39) missense probably benign 0.00
R9571:Gli3 UTSW 13 15,900,858 (GRCm39) missense probably benign 0.00
R9704:Gli3 UTSW 13 15,898,058 (GRCm39) missense probably damaging 1.00
R9787:Gli3 UTSW 13 15,900,386 (GRCm39) missense probably damaging 0.96
RF010:Gli3 UTSW 13 15,900,954 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGTAACAAGCACAGTTGAC -3'
(R):5'- ACATCCCAATCAGGTGAGATGAG -3'

Sequencing Primer
(F):5'- CACAGTTGACAGCTTTGAGAGTC -3'
(R):5'- TCCCAATCAGGTGAGATGAGATTGC -3'
Posted On 2022-09-12