Incidental Mutation 'R9621:Gli3'
ID 724819
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene Name GLI-Kruppel family member GLI3
Synonyms brachyphalangy, Bph
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9621 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 15463235-15730026 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 15726668 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 1547 (S1547A)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510]
AlphaFold Q61602
Predicted Effect probably benign
Transcript: ENSMUST00000110510
AA Change: S1547A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: S1547A

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik C A 12: 55,382,257 H538N probably benign Het
2410131K14Rik C T 5: 118,255,815 T86I possibly damaging Het
Abca1 T C 4: 53,092,918 T289A probably benign Het
Adnp A T 2: 168,182,743 S877R probably benign Het
Akap13 T A 7: 75,736,342 H555Q probably benign Het
Alg6 T A 4: 99,726,894 Y38* probably null Het
Amtn C A 5: 88,380,346 Q93K probably benign Het
Ap2b1 T C 11: 83,402,598 V937A probably damaging Het
Arih1 ATCGTCCGGCTCGTCCTCGTCGTCGTCC ATCGTCC 9: 59,486,237 probably benign Het
Bhmt A G 13: 93,621,571 S211P possibly damaging Het
Bmp1 T C 14: 70,477,866 Y943C probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Cbfb A C 8: 105,178,611 T62P probably damaging Het
Ccdc154 T C 17: 25,167,381 F249L probably damaging Het
Cdh26 T A 2: 178,470,190 F514L probably damaging Het
Cdhr2 A G 13: 54,718,537 E352G Het
Cep295nl G A 11: 118,333,940 P26L possibly damaging Het
Cfdp1 A G 8: 111,845,175 V34A probably damaging Het
Cntnap2 A T 6: 46,988,792 I846F probably damaging Het
Cntrl A G 2: 35,160,266 K1464E probably damaging Het
Crybg3 T C 16: 59,506,250 D1039G possibly damaging Het
Csmd3 A T 15: 47,849,720 S778R Het
Daam2 C T 17: 49,473,304 C729Y probably damaging Het
Ddx18 T C 1: 121,561,403 H305R probably damaging Het
Dio1 C T 4: 107,292,361 C248Y probably benign Het
Dnah1 C A 14: 31,294,815 A1582S probably damaging Het
Eef1a1 A T 9: 78,479,350 D319E probably benign Het
Fam171b G A 2: 83,812,765 R6H probably damaging Het
Fam214a A G 9: 75,010,230 N711D possibly damaging Het
Flnb G A 14: 7,926,421 G1822R probably damaging Het
Gabrb1 G A 5: 72,122,020 V303I possibly damaging Het
Gm4884 A T 7: 41,043,687 N360I possibly damaging Het
Gm9573 T A 17: 35,621,828 T489S unknown Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Ino80 C G 2: 119,450,015 K289N probably damaging Het
Itpr1 G A 6: 108,416,909 E1638K probably damaging Het
Jakmip1 A T 5: 37,117,468 I45F unknown Het
Kif1a G A 1: 93,055,723 P684L probably benign Het
Kpnb1 A T 11: 97,167,634 S610T probably benign Het
Man1a2 A G 3: 100,684,645 V73A probably benign Het
Mbtps1 A G 8: 119,508,882 V1019A possibly damaging Het
Nup210 G C 6: 91,017,393 N1774K probably benign Het
Olfr763 G T 10: 129,011,890 V202F probably benign Het
Pik3c2b T C 1: 133,071,607 S398P probably damaging Het
Pmpca A G 2: 26,389,976 T37A probably benign Het
Ppfia1 A G 7: 144,498,779 S840P probably damaging Het
Prkcq A T 2: 11,256,203 K355N probably benign Het
Ptprg A G 14: 12,237,809 K1422R probably benign Het
Ptprq T C 10: 107,542,662 E2006G probably damaging Het
Qsox1 TG T 1: 155,795,389 probably null Het
Rcor2 A T 19: 7,274,226 T412S probably benign Het
Rnf224 A T 2: 25,236,188 M51K probably benign Het
Robo4 A G 9: 37,406,213 D521G probably damaging Het
Sf3b4 T A 3: 96,176,799 S360T unknown Het
Sgo2b T C 8: 63,927,617 D727G probably damaging Het
Smpd2 C A 10: 41,488,287 V172L probably benign Het
Syne1 C T 10: 5,323,887 A1966T probably benign Het
Syt13 G A 2: 92,915,230 G15D possibly damaging Het
Taf3 A T 2: 9,918,259 L18Q unknown Het
Tcam1 T A 11: 106,285,433 N328K probably damaging Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tet2 A T 3: 133,488,006 Y222* probably null Het
Timm29 A T 9: 21,592,922 probably benign Het
Tmc6 T C 11: 117,779,169 D17G probably benign Het
Tmem30a T A 9: 79,780,644 D81V probably benign Het
Tnnt1 T C 7: 4,508,502 I195V probably benign Het
Ttc30b T C 2: 75,937,800 Y203C probably damaging Het
Ttll5 T A 12: 85,892,122 V398E possibly damaging Het
Ttn T C 2: 76,918,097 T4203A possibly damaging Het
Ubc A G 5: 125,387,447 I272T probably damaging Het
Uhrf1bp1 T A 17: 27,886,779 S760T probably benign Het
Unc45a A G 7: 80,334,037 L337P probably damaging Het
Vmn1r229 T C 17: 20,815,053 F187L probably benign Het
Wrn A T 8: 33,324,273 M381K probably benign Het
Zdbf2 A G 1: 63,303,476 N338S possibly damaging Het
Zfp541 A G 7: 16,071,967 E9G possibly damaging Het
Zrsr1 G A 11: 22,973,418 R64Q possibly damaging Het
Zswim8 T A 14: 20,722,163 S1614T probably benign Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15644299 missense probably damaging 1.00
IGL00471:Gli3 APN 13 15723769 critical splice donor site probably null
IGL00484:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15548398 critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15648634 missense probably damaging 1.00
IGL01799:Gli3 APN 13 15726161 missense probably benign 0.00
IGL01861:Gli3 APN 13 15725325 missense probably damaging 1.00
IGL02063:Gli3 APN 13 15726372 missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15662514 missense probably damaging 1.00
IGL02255:Gli3 APN 13 15648719 missense probably damaging 1.00
IGL02270:Gli3 APN 13 15726786 utr 3 prime probably benign
IGL02336:Gli3 APN 13 15720289 missense probably damaging 1.00
IGL02346:Gli3 APN 13 15723693 missense probably damaging 1.00
IGL02744:Gli3 APN 13 15613886 critical splice donor site probably null
IGL02877:Gli3 APN 13 15724742 missense probably damaging 1.00
IGL02975:Gli3 APN 13 15724568 missense probably damaging 1.00
IGL03018:Gli3 APN 13 15660132 missense probably damaging 1.00
IGL03378:Gli3 APN 13 15644420 missense probably damaging 1.00
IGL03406:Gli3 APN 13 15648581 missense probably damaging 1.00
Capone UTSW 13 15715034 missense probably damaging 1.00
Carpals UTSW 13 15713650 critical splice donor site probably null
Ness UTSW 13 15723555 missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15644357 missense probably damaging 1.00
R0110:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0329:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0330:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0360:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0364:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0469:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0616:Gli3 UTSW 13 15662406 missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15724715 missense probably damaging 1.00
R1072:Gli3 UTSW 13 15713605 missense probably damaging 1.00
R1257:Gli3 UTSW 13 15725996 nonsense probably null
R1270:Gli3 UTSW 13 15723744 missense probably benign 0.02
R1424:Gli3 UTSW 13 15726314 missense probably benign 0.00
R1481:Gli3 UTSW 13 15613850 missense probably damaging 0.99
R1596:Gli3 UTSW 13 15725471 missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15726312 missense probably benign 0.00
R1721:Gli3 UTSW 13 15726297 missense probably benign 0.27
R1797:Gli3 UTSW 13 15713512 missense probably damaging 0.99
R1813:Gli3 UTSW 13 15648691 missense probably damaging 1.00
R1819:Gli3 UTSW 13 15725792 nonsense probably null
R1988:Gli3 UTSW 13 15726380 missense probably benign
R2132:Gli3 UTSW 13 15725549 missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15662392 missense probably benign 0.02
R3085:Gli3 UTSW 13 15660941 missense probably damaging 1.00
R3177:Gli3 UTSW 13 15725982 missense probably benign 0.28
R3277:Gli3 UTSW 13 15725982 missense probably benign 0.28
R4162:Gli3 UTSW 13 15725115 missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15723571 missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15713631 missense probably damaging 1.00
R4979:Gli3 UTSW 13 15724464 missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15548507 missense probably damaging 0.99
R5395:Gli3 UTSW 13 15714950 missense probably damaging 1.00
R5494:Gli3 UTSW 13 15725982 missense probably benign 0.28
R5609:Gli3 UTSW 13 15548453 missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15478165 critical splice donor site probably null
R5810:Gli3 UTSW 13 15644309 missense probably damaging 0.99
R5896:Gli3 UTSW 13 15726180 missense probably benign 0.00
R5930:Gli3 UTSW 13 15548625 missense probably damaging 1.00
R5964:Gli3 UTSW 13 15726162 nonsense probably null
R5985:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6224:Gli3 UTSW 13 15725145 missense probably benign
R6278:Gli3 UTSW 13 15725113 missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15724732 missense probably damaging 1.00
R6383:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6523:Gli3 UTSW 13 15713650 critical splice donor site probably null
R7072:Gli3 UTSW 13 15725695 missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15715062 missense probably damaging 1.00
R7228:Gli3 UTSW 13 15724502 missense probably benign 0.00
R7327:Gli3 UTSW 13 15725559 missense probably benign 0.02
R7451:Gli3 UTSW 13 15726291 missense possibly damaging 0.50
R7974:Gli3 UTSW 13 15726256 missense probably benign 0.00
R8167:Gli3 UTSW 13 15725643 missense probably benign 0.00
R8170:Gli3 UTSW 13 15720208 missense probably benign
R8199:Gli3 UTSW 13 15725991 missense probably benign 0.08
R8247:Gli3 UTSW 13 15726775 missense possibly damaging 0.82
R8332:Gli3 UTSW 13 15713548 missense possibly damaging 0.58
R8347:Gli3 UTSW 13 15723525 missense probably damaging 1.00
R8559:Gli3 UTSW 13 15660132 missense probably damaging 1.00
R8676:Gli3 UTSW 13 15715034 missense probably damaging 1.00
R8905:Gli3 UTSW 13 15726531 missense probably benign 0.01
R9099:Gli3 UTSW 13 15726735 missense probably damaging 1.00
R9260:Gli3 UTSW 13 15725090 missense probably damaging 0.99
R9317:Gli3 UTSW 13 15715073 missense probably damaging 1.00
R9475:Gli3 UTSW 13 15725711 missense possibly damaging 0.87
R9546:Gli3 UTSW 13 15613858 missense probably benign 0.00
R9571:Gli3 UTSW 13 15726273 missense probably benign 0.00
R9704:Gli3 UTSW 13 15723473 missense probably damaging 1.00
R9787:Gli3 UTSW 13 15725801 missense probably damaging 0.96
RF010:Gli3 UTSW 13 15726369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGTAACAAGCACAGTTGAC -3'
(R):5'- ACATCCCAATCAGGTGAGATGAG -3'

Sequencing Primer
(F):5'- CACAGTTGACAGCTTTGAGAGTC -3'
(R):5'- TCCCAATCAGGTGAGATGAGATTGC -3'
Posted On 2022-09-12