Incidental Mutation 'R9621:Flnb'
ID 724822
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Name filamin, beta
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9621 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 7817957-7951588 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 7926421 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 1822 (G1822R)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
AlphaFold Q80X90
Predicted Effect probably damaging
Transcript: ENSMUST00000052678
AA Change: G1822R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: G1822R

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik C A 12: 55,382,257 H538N probably benign Het
2410131K14Rik C T 5: 118,255,815 T86I possibly damaging Het
Abca1 T C 4: 53,092,918 T289A probably benign Het
Adnp A T 2: 168,182,743 S877R probably benign Het
Akap13 T A 7: 75,736,342 H555Q probably benign Het
Alg6 T A 4: 99,726,894 Y38* probably null Het
Amtn C A 5: 88,380,346 Q93K probably benign Het
Ap2b1 T C 11: 83,402,598 V937A probably damaging Het
Arih1 ATCGTCCGGCTCGTCCTCGTCGTCGTCC ATCGTCC 9: 59,486,237 probably benign Het
Bhmt A G 13: 93,621,571 S211P possibly damaging Het
Bmp1 T C 14: 70,477,866 Y943C probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Cbfb A C 8: 105,178,611 T62P probably damaging Het
Ccdc154 T C 17: 25,167,381 F249L probably damaging Het
Cdh26 T A 2: 178,470,190 F514L probably damaging Het
Cdhr2 A G 13: 54,718,537 E352G Het
Cep295nl G A 11: 118,333,940 P26L possibly damaging Het
Cfdp1 A G 8: 111,845,175 V34A probably damaging Het
Cntnap2 A T 6: 46,988,792 I846F probably damaging Het
Cntrl A G 2: 35,160,266 K1464E probably damaging Het
Crybg3 T C 16: 59,506,250 D1039G possibly damaging Het
Csmd3 A T 15: 47,849,720 S778R Het
Daam2 C T 17: 49,473,304 C729Y probably damaging Het
Ddx18 T C 1: 121,561,403 H305R probably damaging Het
Dio1 C T 4: 107,292,361 C248Y probably benign Het
Dnah1 C A 14: 31,294,815 A1582S probably damaging Het
Eef1a1 A T 9: 78,479,350 D319E probably benign Het
Fam171b G A 2: 83,812,765 R6H probably damaging Het
Fam214a A G 9: 75,010,230 N711D possibly damaging Het
Gabrb1 G A 5: 72,122,020 V303I possibly damaging Het
Gli3 T G 13: 15,726,668 S1547A probably benign Het
Gm4884 A T 7: 41,043,687 N360I possibly damaging Het
Gm9573 T A 17: 35,621,828 T489S unknown Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Ino80 C G 2: 119,450,015 K289N probably damaging Het
Itpr1 G A 6: 108,416,909 E1638K probably damaging Het
Jakmip1 A T 5: 37,117,468 I45F unknown Het
Kif1a G A 1: 93,055,723 P684L probably benign Het
Kpnb1 A T 11: 97,167,634 S610T probably benign Het
Man1a2 A G 3: 100,684,645 V73A probably benign Het
Mbtps1 A G 8: 119,508,882 V1019A possibly damaging Het
Nup210 G C 6: 91,017,393 N1774K probably benign Het
Olfr763 G T 10: 129,011,890 V202F probably benign Het
Pik3c2b T C 1: 133,071,607 S398P probably damaging Het
Pmpca A G 2: 26,389,976 T37A probably benign Het
Ppfia1 A G 7: 144,498,779 S840P probably damaging Het
Prkcq A T 2: 11,256,203 K355N probably benign Het
Ptprg A G 14: 12,237,809 K1422R probably benign Het
Ptprq T C 10: 107,542,662 E2006G probably damaging Het
Qsox1 TG T 1: 155,795,389 probably null Het
Rcor2 A T 19: 7,274,226 T412S probably benign Het
Rnf224 A T 2: 25,236,188 M51K probably benign Het
Robo4 A G 9: 37,406,213 D521G probably damaging Het
Sf3b4 T A 3: 96,176,799 S360T unknown Het
Sgo2b T C 8: 63,927,617 D727G probably damaging Het
Smpd2 C A 10: 41,488,287 V172L probably benign Het
Syne1 C T 10: 5,323,887 A1966T probably benign Het
Syt13 G A 2: 92,915,230 G15D possibly damaging Het
Taf3 A T 2: 9,918,259 L18Q unknown Het
Tcam1 T A 11: 106,285,433 N328K probably damaging Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tet2 A T 3: 133,488,006 Y222* probably null Het
Timm29 A T 9: 21,592,922 probably benign Het
Tmc6 T C 11: 117,779,169 D17G probably benign Het
Tmem30a T A 9: 79,780,644 D81V probably benign Het
Tnnt1 T C 7: 4,508,502 I195V probably benign Het
Ttc30b T C 2: 75,937,800 Y203C probably damaging Het
Ttll5 T A 12: 85,892,122 V398E possibly damaging Het
Ttn T C 2: 76,918,097 T4203A possibly damaging Het
Ubc A G 5: 125,387,447 I272T probably damaging Het
Uhrf1bp1 T A 17: 27,886,779 S760T probably benign Het
Unc45a A G 7: 80,334,037 L337P probably damaging Het
Vmn1r229 T C 17: 20,815,053 F187L probably benign Het
Wrn A T 8: 33,324,273 M381K probably benign Het
Zdbf2 A G 1: 63,303,476 N338S possibly damaging Het
Zfp541 A G 7: 16,071,967 E9G possibly damaging Het
Zrsr1 G A 11: 22,973,418 R64Q possibly damaging Het
Zswim8 T A 14: 20,722,163 S1614T probably benign Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7917390 splice site probably benign
IGL01063:Flnb APN 14 7926518 splice site probably benign
IGL01135:Flnb APN 14 7909736 missense probably benign
IGL01139:Flnb APN 14 7945989 missense probably damaging 1.00
IGL01364:Flnb APN 14 7934562 critical splice acceptor site probably null
IGL01417:Flnb APN 14 7905513 missense probably damaging 0.99
IGL01505:Flnb APN 14 7902003 critical splice donor site probably null
IGL01560:Flnb APN 14 7893829 missense probably benign 0.07
IGL01621:Flnb APN 14 7950470 missense probably damaging 1.00
IGL01656:Flnb APN 14 7902010 splice site probably benign
IGL01889:Flnb APN 14 7935967 missense possibly damaging 0.85
IGL01987:Flnb APN 14 7922748 critical splice donor site probably null
IGL02322:Flnb APN 14 7894676 missense probably damaging 1.00
IGL02496:Flnb APN 14 7930919 splice site probably benign
IGL02752:Flnb APN 14 7917338 missense probably benign
IGL03001:Flnb APN 14 7934680 missense probably damaging 0.99
IGL03076:Flnb APN 14 7901988 missense probably benign 0.01
IGL03085:Flnb APN 14 7882211 missense probably benign
IGL03170:Flnb APN 14 7818261 missense possibly damaging 0.90
IGL03373:Flnb APN 14 7890867 critical splice donor site probably null
Boomerang UTSW 14 7901945 missense probably damaging 1.00
Queensland UTSW 14 7927352 missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7942057 missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7896488 missense probably benign 0.15
Rhodelinda UTSW 14 7887682 splice site probably benign
saul UTSW 14 7889183 missense probably damaging 0.99
Xerxes UTSW 14 7867551 missense probably damaging 1.00
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0084:Flnb UTSW 14 7935979 missense probably benign
R0128:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0130:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0148:Flnb UTSW 14 7939077 missense probably benign 0.01
R0166:Flnb UTSW 14 7896115 missense probably damaging 1.00
R0376:Flnb UTSW 14 7946014 critical splice donor site probably null
R0547:Flnb UTSW 14 7912943 splice site probably null
R0612:Flnb UTSW 14 7887682 splice site probably benign
R0656:Flnb UTSW 14 7927352 missense probably damaging 1.00
R0691:Flnb UTSW 14 7890810 missense probably benign 0.16
R1241:Flnb UTSW 14 7896503 missense probably benign 0.06
R1572:Flnb UTSW 14 7883908 missense probably damaging 0.97
R1682:Flnb UTSW 14 7913121 missense probably benign 0.04
R1807:Flnb UTSW 14 7934645 missense probably benign 0.26
R1848:Flnb UTSW 14 7892113 missense probably damaging 1.00
R1959:Flnb UTSW 14 7884735 nonsense probably null
R2078:Flnb UTSW 14 7927466 missense probably damaging 1.00
R2132:Flnb UTSW 14 7873376 missense probably benign 0.04
R2209:Flnb UTSW 14 7905507 nonsense probably null
R2212:Flnb UTSW 14 7881652 small deletion probably benign
R2213:Flnb UTSW 14 7881652 small deletion probably benign
R2363:Flnb UTSW 14 7945950 missense possibly damaging 0.95
R2415:Flnb UTSW 14 7929932 missense probably benign 0.07
R2983:Flnb UTSW 14 7882250 missense probably damaging 1.00
R3001:Flnb UTSW 14 7907162 missense probably benign 0.22
R3002:Flnb UTSW 14 7907162 missense probably benign 0.22
R3436:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3437:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3778:Flnb UTSW 14 7915353 missense probably benign 0.06
R3783:Flnb UTSW 14 7889236 missense probably benign 0.04
R4162:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4163:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4164:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4356:Flnb UTSW 14 7922700 missense probably benign
R4369:Flnb UTSW 14 7942216 missense probably benign
R4783:Flnb UTSW 14 7905701 missense probably benign 0.12
R4785:Flnb UTSW 14 7905701 missense probably benign 0.12
R4790:Flnb UTSW 14 7905661 missense probably benign 0.34
R4828:Flnb UTSW 14 7919238 missense probably benign 0.13
R4882:Flnb UTSW 14 7929936 missense possibly damaging 0.56
R5002:Flnb UTSW 14 7945882 missense probably damaging 1.00
R5058:Flnb UTSW 14 7924262 nonsense probably null
R5184:Flnb UTSW 14 7901945 missense probably damaging 1.00
R5186:Flnb UTSW 14 7909748 missense probably damaging 1.00
R5395:Flnb UTSW 14 7883881 missense probably benign 0.02
R5421:Flnb UTSW 14 7926494 missense probably damaging 1.00
R5667:Flnb UTSW 14 7890843 missense probably benign 0.00
R5671:Flnb UTSW 14 7890843 missense probably benign 0.00
R5714:Flnb UTSW 14 7929073 missense probably damaging 1.00
R5860:Flnb UTSW 14 7931135 missense probably damaging 1.00
R5892:Flnb UTSW 14 7907183 missense probably damaging 1.00
R5924:Flnb UTSW 14 7890765 missense probably benign 0.00
R6131:Flnb UTSW 14 7894635 missense possibly damaging 0.79
R6244:Flnb UTSW 14 7892092 missense probably damaging 1.00
R6489:Flnb UTSW 14 7867551 missense probably damaging 1.00
R6582:Flnb UTSW 14 7892275 critical splice donor site probably null
R6586:Flnb UTSW 14 7929138 missense possibly damaging 0.93
R6611:Flnb UTSW 14 7915318 missense probably damaging 1.00
R6626:Flnb UTSW 14 7929012 missense probably damaging 1.00
R6700:Flnb UTSW 14 7892189 missense probably damaging 0.99
R6738:Flnb UTSW 14 7904536 missense probably benign 0.01
R6864:Flnb UTSW 14 7905640 missense possibly damaging 0.84
R6916:Flnb UTSW 14 7907171 missense probably damaging 0.99
R7117:Flnb UTSW 14 7894214 missense probably benign 0.02
R7164:Flnb UTSW 14 7915944 splice site probably null
R7328:Flnb UTSW 14 7883788 missense possibly damaging 0.95
R7328:Flnb UTSW 14 7894660 nonsense probably null
R7687:Flnb UTSW 14 7924224 missense probably damaging 1.00
R7716:Flnb UTSW 14 7917274 missense possibly damaging 0.64
R7763:Flnb UTSW 14 7926478 missense probably benign 0.00
R7821:Flnb UTSW 14 7939113 missense probably benign 0.00
R7921:Flnb UTSW 14 7933800 missense possibly damaging 0.57
R8008:Flnb UTSW 14 7892155 missense probably damaging 1.00
R8075:Flnb UTSW 14 7913048 missense probably benign 0.00
R8084:Flnb UTSW 14 7907243 missense probably benign 0.00
R8259:Flnb UTSW 14 7889183 missense probably damaging 0.99
R8441:Flnb UTSW 14 7896488 missense probably benign 0.15
R8493:Flnb UTSW 14 7869822 missense probably damaging 0.97
R8508:Flnb UTSW 14 7950394 missense probably damaging 0.98
R8531:Flnb UTSW 14 7929939 missense probably damaging 1.00
R8812:Flnb UTSW 14 7887624 missense probably benign 0.06
R8814:Flnb UTSW 14 7927409 missense probably damaging 1.00
R8825:Flnb UTSW 14 7887566 missense probably damaging 1.00
R8868:Flnb UTSW 14 7908671 missense probably benign 0.02
R8955:Flnb UTSW 14 7892874 missense probably damaging 1.00
R8955:Flnb UTSW 14 7904688 nonsense probably null
R8976:Flnb UTSW 14 7901882 critical splice acceptor site probably null
R9055:Flnb UTSW 14 7908553 missense probably benign 0.00
R9148:Flnb UTSW 14 7817996 start gained probably benign
R9179:Flnb UTSW 14 7887541 nonsense probably null
R9180:Flnb UTSW 14 7818219 missense probably damaging 1.00
R9189:Flnb UTSW 14 7892976 missense possibly damaging 0.90
R9286:Flnb UTSW 14 7873414 missense probably damaging 0.98
R9288:Flnb UTSW 14 7904498 missense probably benign 0.43
R9354:Flnb UTSW 14 7818411 missense probably benign 0.13
R9484:Flnb UTSW 14 7929004 missense probably benign 0.06
R9505:Flnb UTSW 14 7904665 missense probably benign
R9525:Flnb UTSW 14 7905481 missense probably damaging 1.00
R9630:Flnb UTSW 14 7926438 nonsense probably null
R9739:Flnb UTSW 14 7935954 nonsense probably null
R9760:Flnb UTSW 14 7929846 missense probably damaging 0.98
X0066:Flnb UTSW 14 7908636 missense probably damaging 1.00
Z1088:Flnb UTSW 14 7905871 missense probably benign 0.04
Z1176:Flnb UTSW 14 7942066 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TCCCTGATACGCATGTGTCC -3'
(R):5'- AGTGCTTCCATTCACAGCAC -3'

Sequencing Primer
(F):5'- CCTTCTCATTTGTTAAGCTGAGATG -3'
(R):5'- CACAGCACATTTTAATCATGCTC -3'
Posted On 2022-09-12