Incidental Mutation 'R9622:Mug2'
ID 724866
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Name murinoglobulin 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R9622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 122006761-122085965 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122051792 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 582 (S582P)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
AlphaFold P28666
Predicted Effect probably benign
Transcript: ENSMUST00000081777
AA Change: S582P

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: S582P

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T A 11: 23,584,590 K589I probably damaging Het
2610301B20Rik T C 4: 10,893,304 I141T possibly damaging Het
Ablim2 A G 5: 35,849,545 K435E probably damaging Het
Acly T C 11: 100,504,959 T412A probably damaging Het
Aldh3b2 T A 19: 3,979,489 D287E probably benign Het
Asphd1 G A 7: 126,948,802 P110S Het
Atg7 T C 6: 114,678,032 L142P probably benign Het
Atp13a4 T C 16: 29,420,459 I796V Het
Bbx A G 16: 50,274,659 V98A probably damaging Het
Brca2 T C 5: 150,556,945 S2727P probably damaging Het
Camk1 T A 6: 113,341,889 D21V possibly damaging Het
Cdc5l A T 17: 45,404,783 D634E probably benign Het
Cyfip1 A T 7: 55,879,105 D275V possibly damaging Het
Cyp4a30b A G 4: 115,470,965 E477G probably damaging Het
Cyp4f16 C T 17: 32,550,272 P379S probably damaging Het
Dchs2 C T 3: 83,356,459 Q3345* probably null Het
Dnaaf1 A G 8: 119,588,262 T270A possibly damaging Het
Dnah3 A G 7: 119,962,133 V334A Het
Dnhd1 T C 7: 105,704,135 F2832L probably benign Het
Dock8 A G 19: 25,121,181 N623S probably null Het
Eif4enif1 T C 11: 3,215,714 I97T probably benign Het
Elmo1 C G 13: 20,208,140 P29A probably benign Het
Erich6 G C 3: 58,636,741 P142A possibly damaging Het
Fam135b T C 15: 71,525,837 R125G probably damaging Het
Fcrla T A 1: 170,922,239 H83L probably damaging Het
Flt3 C T 5: 147,367,031 E366K possibly damaging Het
Gabbr2 C T 4: 46,724,283 probably null Het
Gigyf1 T A 5: 137,524,664 L809* probably null Het
Glg1 C T 8: 111,172,501 G711R probably damaging Het
Gm13101 A G 4: 143,965,778 S218P probably benign Het
Gp1bb T C 16: 18,620,777 E189G probably benign Het
H2-Q1 A T 17: 35,323,556 I326F probably benign Het
Hoxb3 A T 11: 96,344,594 K116* probably null Het
Kcnb1 T C 2: 167,188,241 Y128C probably damaging Het
Kif5b G A 18: 6,225,672 R171C probably damaging Het
Lcn4 G A 2: 26,671,216 Q18* probably null Het
Lrp1b G A 2: 40,889,342 Q2677* probably null Het
Map4k3 T A 17: 80,651,109 T145S probably damaging Het
Mas1 T C 17: 12,842,011 E175G probably benign Het
Metap2 T C 10: 93,871,504 T202A probably benign Het
Mras A T 9: 99,393,001 M131K probably benign Het
Mtor T C 4: 148,483,712 V1092A probably damaging Het
Myo5b A G 18: 74,714,946 N1085S probably damaging Het
Nav3 T C 10: 109,767,242 T1149A probably benign Het
Nipbl A T 15: 8,336,889 S1239T probably benign Het
Nkpd1 C A 7: 19,523,942 R549S probably benign Het
Olfr3 A G 2: 36,812,609 L161P probably damaging Het
Olfr512 T A 7: 108,713,470 M39K probably benign Het
Olfr641 T A 7: 104,040,315 V173D probably damaging Het
Olfr796 G A 10: 129,608,215 H89Y probably benign Het
Pcdh18 T C 3: 49,756,780 N29D probably benign Het
Pdzrn4 T C 15: 92,397,068 W52R probably benign Het
Plekhb1 T C 7: 100,655,381 K39E probably damaging Het
Psmb4 C A 3: 94,884,974 E212D probably benign Het
Rcc1l A G 5: 134,176,509 L69P probably damaging Het
Robo2 T C 16: 73,933,064 R1082G probably benign Het
Rorb T C 19: 18,977,751 Y167C probably damaging Het
Sbsn GGAAATATGGCAGACAAGTTTGGTCAGGGGGCCCACCATGCTTTTGGTCAGGGCAG GG 7: 30,752,642 probably benign Het
Scaf8 T A 17: 3,197,895 F1164L probably benign Het
Scn10a A T 9: 119,608,980 M1940K probably benign Het
Serpinb2 A G 1: 107,524,568 N292S probably benign Het
Sparcl1 C A 5: 104,087,132 V506L possibly damaging Het
Stt3a A G 9: 36,749,729 V262A possibly damaging Het
Syt17 C A 7: 118,436,968 M58I probably benign Het
Tas2r134 A C 2: 51,628,346 N279T possibly damaging Het
Tbc1d2 T C 4: 46,609,065 E724G probably damaging Het
Teddm1b T A 1: 153,874,874 L143Q Het
Tlk1 T A 2: 70,786,937 R66S probably damaging Het
Tmem139 A T 6: 42,263,242 probably null Het
Tom1l2 T C 11: 60,261,116 Y155C possibly damaging Het
Trmt1l C A 1: 151,428,959 S28* probably null Het
Ttf2 T C 3: 100,952,602 I679V probably benign Het
Unc13b T G 4: 43,172,513 F1114V Het
Vmn2r25 T A 6: 123,839,620 D334V probably damaging Het
Vps13c T G 9: 67,949,433 Y2581D probably damaging Het
Xkr5 A G 8: 18,934,231 S432P probably benign Het
Zc2hc1b G A 10: 13,167,933 P73S possibly damaging Het
Zfhx2 A C 14: 55,066,026 F1500L probably benign Het
Zfp3 T G 11: 70,771,913 S233A possibly damaging Het
Zmat5 T C 11: 4,737,453 W169R probably damaging Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122047487 missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122040654 missense probably damaging 0.99
IGL01314:Mug2 APN 6 122081279 missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122049628 splice site probably benign
IGL01477:Mug2 APN 6 122081684 splice site probably benign
IGL01926:Mug2 APN 6 122036104 splice site probably benign
IGL02019:Mug2 APN 6 122047435 missense probably benign 0.02
IGL02305:Mug2 APN 6 122036056 missense probably benign
IGL02310:Mug2 APN 6 122059123 splice site probably benign
IGL02484:Mug2 APN 6 122072753 missense probably damaging 1.00
IGL02516:Mug2 APN 6 122070843 missense probably damaging 1.00
IGL02531:Mug2 APN 6 122072771 missense probably damaging 1.00
IGL02666:Mug2 APN 6 122081326 missense probably damaging 1.00
IGL02936:Mug2 APN 6 122081387 critical splice donor site probably null
R0114:Mug2 UTSW 6 122040648 missense probably damaging 1.00
R0119:Mug2 UTSW 6 122036063 missense probably benign 0.00
R0123:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122071011 splice site probably benign
R0225:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122081599 missense probably damaging 1.00
R0763:Mug2 UTSW 6 122075294 missense probably benign
R0959:Mug2 UTSW 6 122085495 missense probably benign 0.33
R1104:Mug2 UTSW 6 122059055 missense probably benign
R1239:Mug2 UTSW 6 122081678 splice site probably benign
R1318:Mug2 UTSW 6 122077402 missense probably damaging 1.00
R1460:Mug2 UTSW 6 122040533 splice site probably benign
R1706:Mug2 UTSW 6 122036232 splice site probably benign
R1761:Mug2 UTSW 6 122074705 missense probably benign 0.20
R1901:Mug2 UTSW 6 122071842 missense probably benign 0.02
R1913:Mug2 UTSW 6 122070870 missense probably damaging 1.00
R1943:Mug2 UTSW 6 122079639 missense probably benign
R2054:Mug2 UTSW 6 122077492 missense probably damaging 1.00
R2060:Mug2 UTSW 6 122079612 missense probably benign
R2420:Mug2 UTSW 6 122083460 missense probably damaging 1.00
R2432:Mug2 UTSW 6 122084376 missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122074724 splice site probably null
R2918:Mug2 UTSW 6 122074724 splice site probably null
R3423:Mug2 UTSW 6 122047506 splice site probably benign
R3834:Mug2 UTSW 6 122049787 critical splice donor site probably null
R3902:Mug2 UTSW 6 122075567 missense probably damaging 1.00
R3941:Mug2 UTSW 6 122063563 missense probably benign
R4227:Mug2 UTSW 6 122040732 missense probably benign 0.10
R4284:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4287:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4377:Mug2 UTSW 6 122071007 critical splice donor site probably null
R4419:Mug2 UTSW 6 122079630 missense probably damaging 1.00
R4498:Mug2 UTSW 6 122082752 missense probably damaging 0.99
R4566:Mug2 UTSW 6 122079638 missense probably benign 0.00
R4690:Mug2 UTSW 6 122036296 missense probably benign
R4732:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4733:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4741:Mug2 UTSW 6 122079613 missense probably benign
R4888:Mug2 UTSW 6 122081195 missense probably damaging 1.00
R5199:Mug2 UTSW 6 122040660 missense probably benign
R5347:Mug2 UTSW 6 122081592 missense probably damaging 1.00
R5457:Mug2 UTSW 6 122049729 nonsense probably null
R5495:Mug2 UTSW 6 122079650 missense probably damaging 0.96
R5509:Mug2 UTSW 6 122084381 missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122083500 missense probably null 0.98
R6180:Mug2 UTSW 6 122079606 missense probably benign 0.01
R6184:Mug2 UTSW 6 122037046 missense probably benign
R6199:Mug2 UTSW 6 122047439 missense probably benign 0.05
R6262:Mug2 UTSW 6 122075255 missense probably damaging 1.00
R6416:Mug2 UTSW 6 122082754 missense probably damaging 1.00
R6548:Mug2 UTSW 6 122047442 missense probably damaging 1.00
R6703:Mug2 UTSW 6 122078694 missense probably benign 0.25
R7106:Mug2 UTSW 6 122082721 missense probably damaging 1.00
R7131:Mug2 UTSW 6 122075247 missense probably damaging 1.00
R7372:Mug2 UTSW 6 122083466 missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122047487 missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122040570 missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122079726 missense probably benign 0.00
R7581:Mug2 UTSW 6 122063711 missense probably damaging 1.00
R7582:Mug2 UTSW 6 122079644 missense probably damaging 0.99
R7672:Mug2 UTSW 6 122040719 missense probably benign 0.37
R7713:Mug2 UTSW 6 122078795 missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122081358 missense probably damaging 1.00
R7834:Mug2 UTSW 6 122036282 missense probably benign
R7850:Mug2 UTSW 6 122075211 missense probably damaging 1.00
R8029:Mug2 UTSW 6 122081545 critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122075608 missense probably benign 0.01
R8335:Mug2 UTSW 6 122040584 missense probably benign
R8348:Mug2 UTSW 6 122072233 nonsense probably null
R8557:Mug2 UTSW 6 122063701 missense probably damaging 0.99
R8798:Mug2 UTSW 6 122081610 missense probably damaging 1.00
R8823:Mug2 UTSW 6 122063689 missense possibly damaging 0.89
R9029:Mug2 UTSW 6 122084369 missense probably damaging 1.00
R9153:Mug2 UTSW 6 122040668 missense possibly damaging 0.71
R9185:Mug2 UTSW 6 122077483 missense probably benign 0.06
R9186:Mug2 UTSW 6 122075289 missense probably damaging 0.99
R9418:Mug2 UTSW 6 122040741 missense probably benign 0.00
R9464:Mug2 UTSW 6 122051731 missense probably benign 0.01
Z1177:Mug2 UTSW 6 122037121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTAAATCAATCCCAGGGG -3'
(R):5'- CCCTAGTGTCTGAACAATCACTG -3'

Sequencing Primer
(F):5'- AACTTCAGTTGTGCTTCTGACAG -3'
(R):5'- ACTGTTTCATCAGAGCCAGG -3'
Posted On 2022-09-12