Incidental Mutation 'R9622:Mras'
ID 724883
Institutional Source Beutler Lab
Gene Symbol Mras
Ensembl Gene ENSMUSG00000032470
Gene Name muscle and microspikes RAS
Synonyms 2900078C09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock # R9622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 99385420-99437381 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 99393001 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 131 (M131K)
Ref Sequence ENSEMBL: ENSMUSP00000035045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035045] [ENSMUST00000119472] [ENSMUST00000122384] [ENSMUST00000123771]
AlphaFold O08989
PDB Structure Crystal structure of M-Ras in complex with GDP [X-RAY DIFFRACTION]
Crystal structure of M-Ras in complex with GppNHp [X-RAY DIFFRACTION]
Crystal structure of M-Ras P40D/D41E/L51R in complex with GppNHp [X-RAY DIFFRACTION]
Crystal structure of M-Ras P40D in complex with GppNHp [X-RAY DIFFRACTION]
Crystal structure of M-Ras P40D in complex with GDP [X-RAY DIFFRACTION]
Crystal structure of M-RasD41E in complex with GppNHp (type 1) [X-RAY DIFFRACTION]
Crystal structure of M-RasD41E in complex with GppNHp (type 2) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000035045
AA Change: M131K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035045
Gene: ENSMUSG00000032470
AA Change: M131K

DomainStartEndE-ValueType
RAS 11 178 4.26e-114 SMART
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119472
AA Change: M131K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112407
Gene: ENSMUSG00000032470
AA Change: M131K

DomainStartEndE-ValueType
RAS 11 178 4.26e-114 SMART
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122384
AA Change: M131K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113275
Gene: ENSMUSG00000032470
AA Change: M131K

DomainStartEndE-ValueType
RAS 11 178 4.26e-114 SMART
low complexity region 182 191 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000123771
SMART Domains Protein: ENSMUSP00000121307
Gene: ENSMUSG00000032470

DomainStartEndE-ValueType
RAS 11 130 1.06e-68 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras family of small GTPases. These membrane-associated proteins function as signal transducers in multiple processes including cell growth and differentiation, and dysregulation of Ras signaling has been associated with many types of cancer. The encoded protein may play a role in the tumor necrosis factor-alpha and MAP kinase signaling pathways. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene exhibit a decreased mean percentage of peripheral blood B cells but no other evidence of morphological or neurological defects; mutant astrocytes display normal responsiveness to different trophic factors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T A 11: 23,584,590 K589I probably damaging Het
2610301B20Rik T C 4: 10,893,304 I141T possibly damaging Het
Ablim2 A G 5: 35,849,545 K435E probably damaging Het
Acly T C 11: 100,504,959 T412A probably damaging Het
Aldh3b2 T A 19: 3,979,489 D287E probably benign Het
Asphd1 G A 7: 126,948,802 P110S Het
Atg7 T C 6: 114,678,032 L142P probably benign Het
Atp13a4 T C 16: 29,420,459 I796V Het
Bbx A G 16: 50,274,659 V98A probably damaging Het
Brca2 T C 5: 150,556,945 S2727P probably damaging Het
Camk1 T A 6: 113,341,889 D21V possibly damaging Het
Cdc5l A T 17: 45,404,783 D634E probably benign Het
Cyfip1 A T 7: 55,879,105 D275V possibly damaging Het
Cyp4a30b A G 4: 115,470,965 E477G probably damaging Het
Cyp4f16 C T 17: 32,550,272 P379S probably damaging Het
Dchs2 C T 3: 83,356,459 Q3345* probably null Het
Dnaaf1 A G 8: 119,588,262 T270A possibly damaging Het
Dnah3 A G 7: 119,962,133 V334A Het
Dnhd1 T C 7: 105,704,135 F2832L probably benign Het
Dock8 A G 19: 25,121,181 N623S probably null Het
Eif4enif1 T C 11: 3,215,714 I97T probably benign Het
Elmo1 C G 13: 20,208,140 P29A probably benign Het
Erich6 G C 3: 58,636,741 P142A possibly damaging Het
Fam135b T C 15: 71,525,837 R125G probably damaging Het
Fcrla T A 1: 170,922,239 H83L probably damaging Het
Flt3 C T 5: 147,367,031 E366K possibly damaging Het
Gabbr2 C T 4: 46,724,283 probably null Het
Gigyf1 T A 5: 137,524,664 L809* probably null Het
Glg1 C T 8: 111,172,501 G711R probably damaging Het
Gm13101 A G 4: 143,965,778 S218P probably benign Het
Gp1bb T C 16: 18,620,777 E189G probably benign Het
H2-Q1 A T 17: 35,323,556 I326F probably benign Het
Hoxb3 A T 11: 96,344,594 K116* probably null Het
Kcnb1 T C 2: 167,188,241 Y128C probably damaging Het
Kif5b G A 18: 6,225,672 R171C probably damaging Het
Lcn4 G A 2: 26,671,216 Q18* probably null Het
Lrp1b G A 2: 40,889,342 Q2677* probably null Het
Map4k3 T A 17: 80,651,109 T145S probably damaging Het
Mas1 T C 17: 12,842,011 E175G probably benign Het
Metap2 T C 10: 93,871,504 T202A probably benign Het
Mtor T C 4: 148,483,712 V1092A probably damaging Het
Mug2 T C 6: 122,051,792 S582P probably benign Het
Myo5b A G 18: 74,714,946 N1085S probably damaging Het
Nav3 T C 10: 109,767,242 T1149A probably benign Het
Nipbl A T 15: 8,336,889 S1239T probably benign Het
Nkpd1 C A 7: 19,523,942 R549S probably benign Het
Olfr3 A G 2: 36,812,609 L161P probably damaging Het
Olfr512 T A 7: 108,713,470 M39K probably benign Het
Olfr641 T A 7: 104,040,315 V173D probably damaging Het
Olfr796 G A 10: 129,608,215 H89Y probably benign Het
Pcdh18 T C 3: 49,756,780 N29D probably benign Het
Pdzrn4 T C 15: 92,397,068 W52R probably benign Het
Plekhb1 T C 7: 100,655,381 K39E probably damaging Het
Psmb4 C A 3: 94,884,974 E212D probably benign Het
Rcc1l A G 5: 134,176,509 L69P probably damaging Het
Robo2 T C 16: 73,933,064 R1082G probably benign Het
Rorb T C 19: 18,977,751 Y167C probably damaging Het
Sbsn GGAAATATGGCAGACAAGTTTGGTCAGGGGGCCCACCATGCTTTTGGTCAGGGCAG GG 7: 30,752,642 probably benign Het
Scaf8 T A 17: 3,197,895 F1164L probably benign Het
Scn10a A T 9: 119,608,980 M1940K probably benign Het
Serpinb2 A G 1: 107,524,568 N292S probably benign Het
Sparcl1 C A 5: 104,087,132 V506L possibly damaging Het
Stt3a A G 9: 36,749,729 V262A possibly damaging Het
Syt17 C A 7: 118,436,968 M58I probably benign Het
Tas2r134 A C 2: 51,628,346 N279T possibly damaging Het
Tbc1d2 T C 4: 46,609,065 E724G probably damaging Het
Teddm1b T A 1: 153,874,874 L143Q Het
Tlk1 T A 2: 70,786,937 R66S probably damaging Het
Tmem139 A T 6: 42,263,242 probably null Het
Tom1l2 T C 11: 60,261,116 Y155C possibly damaging Het
Trmt1l C A 1: 151,428,959 S28* probably null Het
Ttf2 T C 3: 100,952,602 I679V probably benign Het
Unc13b T G 4: 43,172,513 F1114V Het
Vmn2r25 T A 6: 123,839,620 D334V probably damaging Het
Vps13c T G 9: 67,949,433 Y2581D probably damaging Het
Xkr5 A G 8: 18,934,231 S432P probably benign Het
Zc2hc1b G A 10: 13,167,933 P73S possibly damaging Het
Zfhx2 A C 14: 55,066,026 F1500L probably benign Het
Zfp3 T G 11: 70,771,913 S233A possibly damaging Het
Zmat5 T C 11: 4,737,453 W169R probably damaging Het
Other mutations in Mras
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Mras APN 9 99411495 missense probably damaging 1.00
R3918:Mras UTSW 9 99411420 missense probably damaging 1.00
R3919:Mras UTSW 9 99411420 missense probably damaging 1.00
R3981:Mras UTSW 9 99411416 missense probably damaging 1.00
R4950:Mras UTSW 9 99394484 missense probably damaging 1.00
R5375:Mras UTSW 9 99394616 missense probably damaging 1.00
R5501:Mras UTSW 9 99411546 missense probably damaging 1.00
R5624:Mras UTSW 9 99411485 missense probably damaging 0.99
R6349:Mras UTSW 9 99394616 missense probably damaging 1.00
R6350:Mras UTSW 9 99411507 missense probably damaging 1.00
R7453:Mras UTSW 9 99389740 missense probably benign 0.01
R8351:Mras UTSW 9 99411495 missense probably damaging 1.00
R8451:Mras UTSW 9 99411495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCAGTAGGAGGCCTTAG -3'
(R):5'- AGTCTGAGAAGAGTTGGGCC -3'

Sequencing Primer
(F):5'- GTCCGTTTTCTAAAGACGGGCAC -3'
(R):5'- GCCCCTGTCTCCTCTGGAAAAG -3'
Posted On 2022-09-12