Incidental Mutation 'R9622:Nipbl'
ID 724898
Institutional Source Beutler Lab
Gene Symbol Nipbl
Ensembl Gene ENSMUSG00000022141
Gene Name NIPBL cohesin loading factor
Synonyms 4921518A06Rik, 4933421G18Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock # R9622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 8290617-8444463 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8336889 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1239 (S1239T)
Ref Sequence ENSEMBL: ENSMUSP00000059385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052965]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000052965
AA Change: S1239T

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: S1239T

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 447 462 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 639 652 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1081 1097 N/A INTRINSIC
low complexity region 1102 1107 N/A INTRINSIC
low complexity region 1114 1139 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1389 1396 N/A INTRINSIC
low complexity region 1577 1586 N/A INTRINSIC
coiled coil region 1628 1656 N/A INTRINSIC
Pfam:Cohesin_HEAT 1788 1829 1.1e-14 PFAM
Pfam:Nipped-B_C 2269 2450 2.8e-68 PFAM
low complexity region 2477 2501 N/A INTRINSIC
low complexity region 2502 2512 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
low complexity region 2626 2632 N/A INTRINSIC
low complexity region 2660 2684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T A 11: 23,584,590 K589I probably damaging Het
2610301B20Rik T C 4: 10,893,304 I141T possibly damaging Het
Ablim2 A G 5: 35,849,545 K435E probably damaging Het
Acly T C 11: 100,504,959 T412A probably damaging Het
Aldh3b2 T A 19: 3,979,489 D287E probably benign Het
Asphd1 G A 7: 126,948,802 P110S Het
Atg7 T C 6: 114,678,032 L142P probably benign Het
Atp13a4 T C 16: 29,420,459 I796V Het
Bbx A G 16: 50,274,659 V98A probably damaging Het
Brca2 T C 5: 150,556,945 S2727P probably damaging Het
Camk1 T A 6: 113,341,889 D21V possibly damaging Het
Cdc5l A T 17: 45,404,783 D634E probably benign Het
Cyfip1 A T 7: 55,879,105 D275V possibly damaging Het
Cyp4a30b A G 4: 115,470,965 E477G probably damaging Het
Cyp4f16 C T 17: 32,550,272 P379S probably damaging Het
Dchs2 C T 3: 83,356,459 Q3345* probably null Het
Dnaaf1 A G 8: 119,588,262 T270A possibly damaging Het
Dnah3 A G 7: 119,962,133 V334A Het
Dnhd1 T C 7: 105,704,135 F2832L probably benign Het
Dock8 A G 19: 25,121,181 N623S probably null Het
Eif4enif1 T C 11: 3,215,714 I97T probably benign Het
Elmo1 C G 13: 20,208,140 P29A probably benign Het
Erich6 G C 3: 58,636,741 P142A possibly damaging Het
Fam135b T C 15: 71,525,837 R125G probably damaging Het
Fcrla T A 1: 170,922,239 H83L probably damaging Het
Flt3 C T 5: 147,367,031 E366K possibly damaging Het
Gabbr2 C T 4: 46,724,283 probably null Het
Gigyf1 T A 5: 137,524,664 L809* probably null Het
Glg1 C T 8: 111,172,501 G711R probably damaging Het
Gm13101 A G 4: 143,965,778 S218P probably benign Het
Gp1bb T C 16: 18,620,777 E189G probably benign Het
H2-Q1 A T 17: 35,323,556 I326F probably benign Het
Hoxb3 A T 11: 96,344,594 K116* probably null Het
Kcnb1 T C 2: 167,188,241 Y128C probably damaging Het
Kif5b G A 18: 6,225,672 R171C probably damaging Het
Lcn4 G A 2: 26,671,216 Q18* probably null Het
Lrp1b G A 2: 40,889,342 Q2677* probably null Het
Map4k3 T A 17: 80,651,109 T145S probably damaging Het
Mas1 T C 17: 12,842,011 E175G probably benign Het
Metap2 T C 10: 93,871,504 T202A probably benign Het
Mras A T 9: 99,393,001 M131K probably benign Het
Mtor T C 4: 148,483,712 V1092A probably damaging Het
Mug2 T C 6: 122,051,792 S582P probably benign Het
Myo5b A G 18: 74,714,946 N1085S probably damaging Het
Nav3 T C 10: 109,767,242 T1149A probably benign Het
Nkpd1 C A 7: 19,523,942 R549S probably benign Het
Olfr3 A G 2: 36,812,609 L161P probably damaging Het
Olfr512 T A 7: 108,713,470 M39K probably benign Het
Olfr641 T A 7: 104,040,315 V173D probably damaging Het
Olfr796 G A 10: 129,608,215 H89Y probably benign Het
Pcdh18 T C 3: 49,756,780 N29D probably benign Het
Pdzrn4 T C 15: 92,397,068 W52R probably benign Het
Plekhb1 T C 7: 100,655,381 K39E probably damaging Het
Psmb4 C A 3: 94,884,974 E212D probably benign Het
Rcc1l A G 5: 134,176,509 L69P probably damaging Het
Robo2 T C 16: 73,933,064 R1082G probably benign Het
Rorb T C 19: 18,977,751 Y167C probably damaging Het
Sbsn GGAAATATGGCAGACAAGTTTGGTCAGGGGGCCCACCATGCTTTTGGTCAGGGCAG GG 7: 30,752,642 probably benign Het
Scaf8 T A 17: 3,197,895 F1164L probably benign Het
Scn10a A T 9: 119,608,980 M1940K probably benign Het
Serpinb2 A G 1: 107,524,568 N292S probably benign Het
Sparcl1 C A 5: 104,087,132 V506L possibly damaging Het
Stt3a A G 9: 36,749,729 V262A possibly damaging Het
Syt17 C A 7: 118,436,968 M58I probably benign Het
Tas2r134 A C 2: 51,628,346 N279T possibly damaging Het
Tbc1d2 T C 4: 46,609,065 E724G probably damaging Het
Teddm1b T A 1: 153,874,874 L143Q Het
Tlk1 T A 2: 70,786,937 R66S probably damaging Het
Tmem139 A T 6: 42,263,242 probably null Het
Tom1l2 T C 11: 60,261,116 Y155C possibly damaging Het
Trmt1l C A 1: 151,428,959 S28* probably null Het
Ttf2 T C 3: 100,952,602 I679V probably benign Het
Unc13b T G 4: 43,172,513 F1114V Het
Vmn2r25 T A 6: 123,839,620 D334V probably damaging Het
Vps13c T G 9: 67,949,433 Y2581D probably damaging Het
Xkr5 A G 8: 18,934,231 S432P probably benign Het
Zc2hc1b G A 10: 13,167,933 P73S possibly damaging Het
Zfhx2 A C 14: 55,066,026 F1500L probably benign Het
Zfp3 T G 11: 70,771,913 S233A possibly damaging Het
Zmat5 T C 11: 4,737,453 W169R probably damaging Het
Other mutations in Nipbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Nipbl APN 15 8366673 missense probably damaging 0.98
IGL00712:Nipbl APN 15 8369474 missense probably damaging 0.97
IGL00789:Nipbl APN 15 8296869 missense probably damaging 1.00
IGL01025:Nipbl APN 15 8350455 missense possibly damaging 0.46
IGL01087:Nipbl APN 15 8350497 missense possibly damaging 0.67
IGL01474:Nipbl APN 15 8311209 missense possibly damaging 0.63
IGL01537:Nipbl APN 15 8350539 missense probably benign
IGL01723:Nipbl APN 15 8335071 missense possibly damaging 0.71
IGL01749:Nipbl APN 15 8361821 missense probably benign 0.13
IGL02398:Nipbl APN 15 8327090 missense probably damaging 1.00
IGL02437:Nipbl APN 15 8359074 missense probably damaging 1.00
IGL02450:Nipbl APN 15 8343574 missense probably damaging 0.99
IGL02477:Nipbl APN 15 8323647 splice site probably null
IGL02547:Nipbl APN 15 8351598 missense probably benign
IGL02678:Nipbl APN 15 8351110 missense possibly damaging 0.92
IGL02679:Nipbl APN 15 8295553 missense probably benign 0.34
IGL03003:Nipbl APN 15 8350314 missense probably damaging 1.00
IGL03117:Nipbl APN 15 8332452 missense probably damaging 1.00
IGL03162:Nipbl APN 15 8338979 missense probably benign 0.37
IGL03224:Nipbl APN 15 8293085 missense probably damaging 0.98
IGL03339:Nipbl APN 15 8350876 missense probably benign 0.12
R0346_Nipbl_297 UTSW 15 8360956 missense probably damaging 0.99
R0347_Nipbl_476 UTSW 15 8350732 missense probably benign
R3620_nipbl_616 UTSW 15 8333024 missense probably damaging 0.99
R6388_Nipbl_651 UTSW 15 8300784 missense probably damaging 0.99
R8441_Nipbl_224 UTSW 15 8293115 missense probably benign 0.00
R0271:Nipbl UTSW 15 8361737 missense possibly damaging 0.76
R0346:Nipbl UTSW 15 8360956 missense probably damaging 0.99
R0347:Nipbl UTSW 15 8350732 missense probably benign
R0422:Nipbl UTSW 15 8351628 missense probably benign
R0486:Nipbl UTSW 15 8338870 splice site probably benign
R0652:Nipbl UTSW 15 8303480 missense probably benign 0.23
R0667:Nipbl UTSW 15 8361004 missense possibly damaging 0.86
R0689:Nipbl UTSW 15 8293078 splice site probably null
R0726:Nipbl UTSW 15 8351555 missense probably benign
R0881:Nipbl UTSW 15 8307612 missense probably damaging 0.98
R0904:Nipbl UTSW 15 8361718 missense probably benign
R0969:Nipbl UTSW 15 8292228 missense probably damaging 1.00
R1401:Nipbl UTSW 15 8372173 missense probably damaging 0.97
R1479:Nipbl UTSW 15 8350289 missense probably benign 0.00
R1495:Nipbl UTSW 15 8351280 missense probably benign 0.00
R1609:Nipbl UTSW 15 8366664 missense probably damaging 1.00
R1679:Nipbl UTSW 15 8302912 missense probably benign 0.31
R1756:Nipbl UTSW 15 8338551 missense possibly damaging 0.91
R1778:Nipbl UTSW 15 8319488 missense probably damaging 1.00
R1835:Nipbl UTSW 15 8343517 missense possibly damaging 0.80
R1883:Nipbl UTSW 15 8327132 missense probably damaging 1.00
R1914:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R1915:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R2030:Nipbl UTSW 15 8350287 missense probably damaging 1.00
R2046:Nipbl UTSW 15 8324467 missense probably benign 0.08
R2076:Nipbl UTSW 15 8311207 missense probably benign 0.11
R2163:Nipbl UTSW 15 8336919 missense probably damaging 0.99
R2170:Nipbl UTSW 15 8293218 missense probably damaging 1.00
R2425:Nipbl UTSW 15 8351482 missense probably benign 0.06
R2475:Nipbl UTSW 15 8335006 missense probably benign 0.05
R2484:Nipbl UTSW 15 8323698 missense probably damaging 0.99
R2970:Nipbl UTSW 15 8311239 missense probably damaging 1.00
R3116:Nipbl UTSW 15 8343592 missense probably benign 0.00
R3620:Nipbl UTSW 15 8333024 missense probably damaging 0.99
R3725:Nipbl UTSW 15 8295661 missense probably damaging 0.97
R3745:Nipbl UTSW 15 8358874 missense probably benign
R3902:Nipbl UTSW 15 8350246 missense possibly damaging 0.94
R3960:Nipbl UTSW 15 8350534 missense probably benign
R4164:Nipbl UTSW 15 8338934 missense probably benign 0.24
R4246:Nipbl UTSW 15 8332432 missense probably damaging 1.00
R4381:Nipbl UTSW 15 8359206 missense probably benign 0.00
R4394:Nipbl UTSW 15 8361861 missense probably benign 0.00
R4439:Nipbl UTSW 15 8338724 missense probably damaging 0.98
R4440:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4441:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4672:Nipbl UTSW 15 8302984 missense probably damaging 1.00
R4749:Nipbl UTSW 15 8365829 missense possibly damaging 0.95
R5300:Nipbl UTSW 15 8351497 missense probably benign
R5428:Nipbl UTSW 15 8330296 missense probably benign 0.00
R5641:Nipbl UTSW 15 8366712 missense possibly damaging 0.93
R5643:Nipbl UTSW 15 8358907 missense probably benign
R5644:Nipbl UTSW 15 8358907 missense probably benign
R5681:Nipbl UTSW 15 8301382 missense probably benign 0.22
R5741:Nipbl UTSW 15 8324649 missense possibly damaging 0.47
R5899:Nipbl UTSW 15 8334844 splice site probably null
R5970:Nipbl UTSW 15 8296818 missense probably benign 0.27
R6041:Nipbl UTSW 15 8324264 missense probably damaging 1.00
R6059:Nipbl UTSW 15 8295568 missense probably damaging 1.00
R6213:Nipbl UTSW 15 8334906 missense probably damaging 1.00
R6216:Nipbl UTSW 15 8318383 missense probably damaging 0.99
R6236:Nipbl UTSW 15 8324580 missense possibly damaging 0.88
R6267:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6296:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6388:Nipbl UTSW 15 8300784 missense probably damaging 0.99
R6427:Nipbl UTSW 15 8351565 missense probably benign
R6707:Nipbl UTSW 15 8324559 missense probably benign 0.01
R6731:Nipbl UTSW 15 8322590 missense probably damaging 1.00
R6921:Nipbl UTSW 15 8303485 missense probably benign 0.28
R7239:Nipbl UTSW 15 8292135 critical splice donor site probably null
R7346:Nipbl UTSW 15 8343606 missense possibly damaging 0.94
R7485:Nipbl UTSW 15 8330295 missense probably benign 0.01
R7486:Nipbl UTSW 15 8295636 missense probably benign 0.25
R7598:Nipbl UTSW 15 8343493 missense probably benign 0.24
R7609:Nipbl UTSW 15 8305872 missense probably benign 0.27
R7674:Nipbl UTSW 15 8293101 missense probably benign 0.15
R7706:Nipbl UTSW 15 8351526 missense probably benign 0.01
R7760:Nipbl UTSW 15 8358702 missense probably damaging 1.00
R7766:Nipbl UTSW 15 8296849 missense probably benign 0.45
R7825:Nipbl UTSW 15 8291487 missense probably damaging 1.00
R7862:Nipbl UTSW 15 8325752 missense probably benign 0.06
R7958:Nipbl UTSW 15 8311258 missense possibly damaging 0.91
R8077:Nipbl UTSW 15 8311250 missense possibly damaging 0.49
R8119:Nipbl UTSW 15 8359212 missense probably benign 0.22
R8355:Nipbl UTSW 15 8335044 missense probably damaging 0.98
R8441:Nipbl UTSW 15 8293115 missense probably benign 0.00
R8455:Nipbl UTSW 15 8335044 missense probably damaging 0.98
R8717:Nipbl UTSW 15 8338741 missense probably benign
R8739:Nipbl UTSW 15 8303420 missense probably benign 0.08
R8854:Nipbl UTSW 15 8300726 missense probably damaging 1.00
R8887:Nipbl UTSW 15 8361787 missense probably damaging 1.00
R8942:Nipbl UTSW 15 8351620 missense probably benign
R8991:Nipbl UTSW 15 8291513 missense probably damaging 1.00
R9008:Nipbl UTSW 15 8327124 missense probably damaging 1.00
R9070:Nipbl UTSW 15 8338731 missense possibly damaging 0.82
R9116:Nipbl UTSW 15 8350856 missense probably benign 0.00
R9778:Nipbl UTSW 15 8291548 missense probably benign 0.10
RF020:Nipbl UTSW 15 8358934 missense probably damaging 0.98
X0022:Nipbl UTSW 15 8351715 missense probably benign 0.05
X0027:Nipbl UTSW 15 8323537 missense probably damaging 1.00
Z1088:Nipbl UTSW 15 8307882 missense probably damaging 1.00
Z1176:Nipbl UTSW 15 8338699 missense possibly damaging 0.88
Z1177:Nipbl UTSW 15 8336952 missense probably damaging 1.00
Z1177:Nipbl UTSW 15 8338680 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATCCATTCTTCTGTCAATGCACAC -3'
(R):5'- GACTTGTGTCATCCCTGCTG -3'

Sequencing Primer
(F):5'- CTGTCAATGCACACATAATTTTGG -3'
(R):5'- CGTGTGGTTTACAGAACTCTGAAAC -3'
Posted On 2022-09-12