Incidental Mutation 'R9622:Nipbl'
ID 724898
Institutional Source Beutler Lab
Gene Symbol Nipbl
Ensembl Gene ENSMUSG00000022141
Gene Name NIPBL cohesin loading factor
Synonyms 4933421G18Rik, 4921518A06Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R9622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 8320101-8473947 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8366373 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1239 (S1239T)
Ref Sequence ENSEMBL: ENSMUSP00000059385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052965]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000052965
AA Change: S1239T

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: S1239T

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 447 462 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 639 652 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1081 1097 N/A INTRINSIC
low complexity region 1102 1107 N/A INTRINSIC
low complexity region 1114 1139 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1389 1396 N/A INTRINSIC
low complexity region 1577 1586 N/A INTRINSIC
coiled coil region 1628 1656 N/A INTRINSIC
Pfam:Cohesin_HEAT 1788 1829 1.1e-14 PFAM
Pfam:Nipped-B_C 2269 2450 2.8e-68 PFAM
low complexity region 2477 2501 N/A INTRINSIC
low complexity region 2502 2512 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
low complexity region 2626 2632 N/A INTRINSIC
low complexity region 2660 2684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 A G 5: 36,006,889 (GRCm39) K435E probably damaging Het
Acly T C 11: 100,395,785 (GRCm39) T412A probably damaging Het
Aldh3b2 T A 19: 4,029,489 (GRCm39) D287E probably benign Het
Asphd1 G A 7: 126,547,974 (GRCm39) P110S Het
Atg7 T C 6: 114,654,993 (GRCm39) L142P probably benign Het
Atp13a4 T C 16: 29,239,277 (GRCm39) I796V Het
Bbx A G 16: 50,095,022 (GRCm39) V98A probably damaging Het
Brca2 T C 5: 150,480,410 (GRCm39) S2727P probably damaging Het
Camk1 T A 6: 113,318,850 (GRCm39) D21V possibly damaging Het
Cdc5l A T 17: 45,715,709 (GRCm39) D634E probably benign Het
Cfap418 T C 4: 10,893,304 (GRCm39) I141T possibly damaging Het
Cyfip1 A T 7: 55,528,853 (GRCm39) D275V possibly damaging Het
Cyp4a30b A G 4: 115,328,162 (GRCm39) E477G probably damaging Het
Cyp4f16 C T 17: 32,769,246 (GRCm39) P379S probably damaging Het
Dchs2 C T 3: 83,263,766 (GRCm39) Q3345* probably null Het
Dnaaf1 A G 8: 120,315,001 (GRCm39) T270A possibly damaging Het
Dnah3 A G 7: 119,561,356 (GRCm39) V334A Het
Dnhd1 T C 7: 105,353,342 (GRCm39) F2832L probably benign Het
Dock8 A G 19: 25,098,545 (GRCm39) N623S probably null Het
Eif4enif1 T C 11: 3,165,714 (GRCm39) I97T probably benign Het
Elmo1 C G 13: 20,392,310 (GRCm39) P29A probably benign Het
Erich6 G C 3: 58,544,162 (GRCm39) P142A possibly damaging Het
Fam135b T C 15: 71,397,686 (GRCm39) R125G probably damaging Het
Fcrla T A 1: 170,749,808 (GRCm39) H83L probably damaging Het
Flt3 C T 5: 147,303,841 (GRCm39) E366K possibly damaging Het
Gabbr2 C T 4: 46,724,283 (GRCm39) probably null Het
Gigyf1 T A 5: 137,522,926 (GRCm39) L809* probably null Het
Glg1 C T 8: 111,899,133 (GRCm39) G711R probably damaging Het
Gp1bb T C 16: 18,439,527 (GRCm39) E189G probably benign Het
H2-Q1 A T 17: 35,542,532 (GRCm39) I326F probably benign Het
Hoxb3 A T 11: 96,235,420 (GRCm39) K116* probably null Het
Kcnb1 T C 2: 167,030,161 (GRCm39) Y128C probably damaging Het
Kif5b G A 18: 6,225,672 (GRCm39) R171C probably damaging Het
Lcn4 G A 2: 26,561,228 (GRCm39) Q18* probably null Het
Lrp1b G A 2: 40,779,354 (GRCm39) Q2677* probably null Het
Map4k3 T A 17: 80,958,538 (GRCm39) T145S probably damaging Het
Mas1 T C 17: 13,060,898 (GRCm39) E175G probably benign Het
Metap2 T C 10: 93,707,366 (GRCm39) T202A probably benign Het
Mras A T 9: 99,275,054 (GRCm39) M131K probably benign Het
Mtor T C 4: 148,568,169 (GRCm39) V1092A probably damaging Het
Mug2 T C 6: 122,028,751 (GRCm39) S582P probably benign Het
Myo5b A G 18: 74,848,017 (GRCm39) N1085S probably damaging Het
Nav3 T C 10: 109,603,103 (GRCm39) T1149A probably benign Het
Nkpd1 C A 7: 19,257,867 (GRCm39) R549S probably benign Het
Or10a3m T A 7: 108,312,677 (GRCm39) M39K probably benign Het
Or10p1 G A 10: 129,444,084 (GRCm39) H89Y probably benign Het
Or1j1 A G 2: 36,702,621 (GRCm39) L161P probably damaging Het
Or51i2 T A 7: 103,689,522 (GRCm39) V173D probably damaging Het
Pcdh18 T C 3: 49,711,229 (GRCm39) N29D probably benign Het
Pdzrn4 T C 15: 92,294,949 (GRCm39) W52R probably benign Het
Plekhb1 T C 7: 100,304,588 (GRCm39) K39E probably damaging Het
Pramel28 A G 4: 143,692,348 (GRCm39) S218P probably benign Het
Psmb4 C A 3: 94,792,285 (GRCm39) E212D probably benign Het
Rcc1l A G 5: 134,205,348 (GRCm39) L69P probably damaging Het
Robo2 T C 16: 73,729,952 (GRCm39) R1082G probably benign Het
Rorb T C 19: 18,955,115 (GRCm39) Y167C probably damaging Het
Sanbr T A 11: 23,534,590 (GRCm39) K589I probably damaging Het
Sbsn GGAAATATGGCAGACAAGTTTGGTCAGGGGGCCCACCATGCTTTTGGTCAGGGCAG GG 7: 30,452,067 (GRCm39) probably benign Het
Scaf8 T A 17: 3,248,170 (GRCm39) F1164L probably benign Het
Scn10a A T 9: 119,438,046 (GRCm39) M1940K probably benign Het
Serpinb2 A G 1: 107,452,298 (GRCm39) N292S probably benign Het
Sparcl1 C A 5: 104,234,998 (GRCm39) V506L possibly damaging Het
Stt3a A G 9: 36,661,025 (GRCm39) V262A possibly damaging Het
Syt17 C A 7: 118,036,191 (GRCm39) M58I probably benign Het
Tas2r134 A C 2: 51,518,358 (GRCm39) N279T possibly damaging Het
Tbc1d2 T C 4: 46,609,065 (GRCm39) E724G probably damaging Het
Teddm1b T A 1: 153,750,620 (GRCm39) L143Q Het
Tlk1 T A 2: 70,617,281 (GRCm39) R66S probably damaging Het
Tmem139 A T 6: 42,240,176 (GRCm39) probably null Het
Tom1l2 T C 11: 60,151,942 (GRCm39) Y155C possibly damaging Het
Trmt1l C A 1: 151,304,710 (GRCm39) S28* probably null Het
Ttf2 T C 3: 100,859,918 (GRCm39) I679V probably benign Het
Unc13b T G 4: 43,172,513 (GRCm39) F1114V Het
Vmn2r25 T A 6: 123,816,579 (GRCm39) D334V probably damaging Het
Vps13c T G 9: 67,856,715 (GRCm39) Y2581D probably damaging Het
Xkr5 A G 8: 18,984,247 (GRCm39) S432P probably benign Het
Zc2hc1b G A 10: 13,043,677 (GRCm39) P73S possibly damaging Het
Zfhx2 A C 14: 55,303,483 (GRCm39) F1500L probably benign Het
Zfp3 T G 11: 70,662,739 (GRCm39) S233A possibly damaging Het
Zmat5 T C 11: 4,687,453 (GRCm39) W169R probably damaging Het
Other mutations in Nipbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Nipbl APN 15 8,396,157 (GRCm39) missense probably damaging 0.98
IGL00712:Nipbl APN 15 8,398,958 (GRCm39) missense probably damaging 0.97
IGL00789:Nipbl APN 15 8,326,353 (GRCm39) missense probably damaging 1.00
IGL01025:Nipbl APN 15 8,379,939 (GRCm39) missense possibly damaging 0.46
IGL01087:Nipbl APN 15 8,379,981 (GRCm39) missense possibly damaging 0.67
IGL01474:Nipbl APN 15 8,340,693 (GRCm39) missense possibly damaging 0.63
IGL01537:Nipbl APN 15 8,380,023 (GRCm39) missense probably benign
IGL01723:Nipbl APN 15 8,364,555 (GRCm39) missense possibly damaging 0.71
IGL01749:Nipbl APN 15 8,391,305 (GRCm39) missense probably benign 0.13
IGL02398:Nipbl APN 15 8,356,574 (GRCm39) missense probably damaging 1.00
IGL02437:Nipbl APN 15 8,388,558 (GRCm39) missense probably damaging 1.00
IGL02450:Nipbl APN 15 8,373,058 (GRCm39) missense probably damaging 0.99
IGL02477:Nipbl APN 15 8,353,131 (GRCm39) splice site probably null
IGL02547:Nipbl APN 15 8,381,082 (GRCm39) missense probably benign
IGL02678:Nipbl APN 15 8,380,594 (GRCm39) missense possibly damaging 0.92
IGL02679:Nipbl APN 15 8,325,037 (GRCm39) missense probably benign 0.34
IGL03003:Nipbl APN 15 8,379,798 (GRCm39) missense probably damaging 1.00
IGL03117:Nipbl APN 15 8,361,936 (GRCm39) missense probably damaging 1.00
IGL03162:Nipbl APN 15 8,368,463 (GRCm39) missense probably benign 0.37
IGL03224:Nipbl APN 15 8,322,569 (GRCm39) missense probably damaging 0.98
IGL03339:Nipbl APN 15 8,380,360 (GRCm39) missense probably benign 0.12
R0346_Nipbl_297 UTSW 15 8,390,440 (GRCm39) missense probably damaging 0.99
R0347_Nipbl_476 UTSW 15 8,380,216 (GRCm39) missense probably benign
R3620_nipbl_616 UTSW 15 8,362,508 (GRCm39) missense probably damaging 0.99
R6388_Nipbl_651 UTSW 15 8,330,268 (GRCm39) missense probably damaging 0.99
R8441_Nipbl_224 UTSW 15 8,322,599 (GRCm39) missense probably benign 0.00
R0271:Nipbl UTSW 15 8,391,221 (GRCm39) missense possibly damaging 0.76
R0346:Nipbl UTSW 15 8,390,440 (GRCm39) missense probably damaging 0.99
R0347:Nipbl UTSW 15 8,380,216 (GRCm39) missense probably benign
R0422:Nipbl UTSW 15 8,381,112 (GRCm39) missense probably benign
R0486:Nipbl UTSW 15 8,368,354 (GRCm39) splice site probably benign
R0652:Nipbl UTSW 15 8,332,964 (GRCm39) missense probably benign 0.23
R0667:Nipbl UTSW 15 8,390,488 (GRCm39) missense possibly damaging 0.86
R0689:Nipbl UTSW 15 8,322,562 (GRCm39) splice site probably null
R0726:Nipbl UTSW 15 8,381,039 (GRCm39) missense probably benign
R0881:Nipbl UTSW 15 8,337,096 (GRCm39) missense probably damaging 0.98
R0904:Nipbl UTSW 15 8,391,202 (GRCm39) missense probably benign
R0969:Nipbl UTSW 15 8,321,712 (GRCm39) missense probably damaging 1.00
R1401:Nipbl UTSW 15 8,401,657 (GRCm39) missense probably damaging 0.97
R1479:Nipbl UTSW 15 8,379,773 (GRCm39) missense probably benign 0.00
R1495:Nipbl UTSW 15 8,380,764 (GRCm39) missense probably benign 0.00
R1609:Nipbl UTSW 15 8,396,148 (GRCm39) missense probably damaging 1.00
R1679:Nipbl UTSW 15 8,332,396 (GRCm39) missense probably benign 0.31
R1756:Nipbl UTSW 15 8,368,035 (GRCm39) missense possibly damaging 0.91
R1778:Nipbl UTSW 15 8,348,972 (GRCm39) missense probably damaging 1.00
R1835:Nipbl UTSW 15 8,373,001 (GRCm39) missense possibly damaging 0.80
R1883:Nipbl UTSW 15 8,356,616 (GRCm39) missense probably damaging 1.00
R1914:Nipbl UTSW 15 8,373,114 (GRCm39) missense possibly damaging 0.93
R1915:Nipbl UTSW 15 8,373,114 (GRCm39) missense possibly damaging 0.93
R2030:Nipbl UTSW 15 8,379,771 (GRCm39) missense probably damaging 1.00
R2046:Nipbl UTSW 15 8,353,951 (GRCm39) missense probably benign 0.08
R2076:Nipbl UTSW 15 8,340,691 (GRCm39) missense probably benign 0.11
R2163:Nipbl UTSW 15 8,366,403 (GRCm39) missense probably damaging 0.99
R2170:Nipbl UTSW 15 8,322,702 (GRCm39) missense probably damaging 1.00
R2425:Nipbl UTSW 15 8,380,966 (GRCm39) missense probably benign 0.06
R2475:Nipbl UTSW 15 8,364,490 (GRCm39) missense probably benign 0.05
R2484:Nipbl UTSW 15 8,353,182 (GRCm39) missense probably damaging 0.99
R2970:Nipbl UTSW 15 8,340,723 (GRCm39) missense probably damaging 1.00
R3116:Nipbl UTSW 15 8,373,076 (GRCm39) missense probably benign 0.00
R3620:Nipbl UTSW 15 8,362,508 (GRCm39) missense probably damaging 0.99
R3725:Nipbl UTSW 15 8,325,145 (GRCm39) missense probably damaging 0.97
R3745:Nipbl UTSW 15 8,388,358 (GRCm39) missense probably benign
R3902:Nipbl UTSW 15 8,379,730 (GRCm39) missense possibly damaging 0.94
R3960:Nipbl UTSW 15 8,380,018 (GRCm39) missense probably benign
R4164:Nipbl UTSW 15 8,368,418 (GRCm39) missense probably benign 0.24
R4246:Nipbl UTSW 15 8,361,916 (GRCm39) missense probably damaging 1.00
R4381:Nipbl UTSW 15 8,388,690 (GRCm39) missense probably benign 0.00
R4394:Nipbl UTSW 15 8,391,345 (GRCm39) missense probably benign 0.00
R4439:Nipbl UTSW 15 8,368,208 (GRCm39) missense probably damaging 0.98
R4440:Nipbl UTSW 15 8,396,142 (GRCm39) missense probably damaging 0.98
R4441:Nipbl UTSW 15 8,396,142 (GRCm39) missense probably damaging 0.98
R4672:Nipbl UTSW 15 8,332,468 (GRCm39) missense probably damaging 1.00
R4749:Nipbl UTSW 15 8,395,313 (GRCm39) missense possibly damaging 0.95
R5300:Nipbl UTSW 15 8,380,981 (GRCm39) missense probably benign
R5428:Nipbl UTSW 15 8,359,780 (GRCm39) missense probably benign 0.00
R5641:Nipbl UTSW 15 8,396,196 (GRCm39) missense possibly damaging 0.93
R5643:Nipbl UTSW 15 8,388,391 (GRCm39) missense probably benign
R5644:Nipbl UTSW 15 8,388,391 (GRCm39) missense probably benign
R5681:Nipbl UTSW 15 8,330,866 (GRCm39) missense probably benign 0.22
R5741:Nipbl UTSW 15 8,354,133 (GRCm39) missense possibly damaging 0.47
R5899:Nipbl UTSW 15 8,364,328 (GRCm39) splice site probably null
R5970:Nipbl UTSW 15 8,326,302 (GRCm39) missense probably benign 0.27
R6041:Nipbl UTSW 15 8,353,748 (GRCm39) missense probably damaging 1.00
R6059:Nipbl UTSW 15 8,325,052 (GRCm39) missense probably damaging 1.00
R6213:Nipbl UTSW 15 8,364,390 (GRCm39) missense probably damaging 1.00
R6216:Nipbl UTSW 15 8,347,867 (GRCm39) missense probably damaging 0.99
R6236:Nipbl UTSW 15 8,354,064 (GRCm39) missense possibly damaging 0.88
R6267:Nipbl UTSW 15 8,330,379 (GRCm39) missense possibly damaging 0.46
R6296:Nipbl UTSW 15 8,330,379 (GRCm39) missense possibly damaging 0.46
R6388:Nipbl UTSW 15 8,330,268 (GRCm39) missense probably damaging 0.99
R6427:Nipbl UTSW 15 8,381,049 (GRCm39) missense probably benign
R6707:Nipbl UTSW 15 8,354,043 (GRCm39) missense probably benign 0.01
R6731:Nipbl UTSW 15 8,352,074 (GRCm39) missense probably damaging 1.00
R6921:Nipbl UTSW 15 8,332,969 (GRCm39) missense probably benign 0.28
R7239:Nipbl UTSW 15 8,321,619 (GRCm39) critical splice donor site probably null
R7346:Nipbl UTSW 15 8,373,090 (GRCm39) missense possibly damaging 0.94
R7485:Nipbl UTSW 15 8,359,779 (GRCm39) missense probably benign 0.01
R7486:Nipbl UTSW 15 8,325,120 (GRCm39) missense probably benign 0.25
R7598:Nipbl UTSW 15 8,372,977 (GRCm39) missense probably benign 0.24
R7609:Nipbl UTSW 15 8,335,356 (GRCm39) missense probably benign 0.27
R7674:Nipbl UTSW 15 8,322,585 (GRCm39) missense probably benign 0.15
R7706:Nipbl UTSW 15 8,381,010 (GRCm39) missense probably benign 0.01
R7760:Nipbl UTSW 15 8,388,186 (GRCm39) missense probably damaging 1.00
R7766:Nipbl UTSW 15 8,326,333 (GRCm39) missense probably benign 0.45
R7825:Nipbl UTSW 15 8,320,971 (GRCm39) missense probably damaging 1.00
R7862:Nipbl UTSW 15 8,355,236 (GRCm39) missense probably benign 0.06
R7958:Nipbl UTSW 15 8,340,742 (GRCm39) missense possibly damaging 0.91
R8077:Nipbl UTSW 15 8,340,734 (GRCm39) missense possibly damaging 0.49
R8119:Nipbl UTSW 15 8,388,696 (GRCm39) missense probably benign 0.22
R8355:Nipbl UTSW 15 8,364,528 (GRCm39) missense probably damaging 0.98
R8441:Nipbl UTSW 15 8,322,599 (GRCm39) missense probably benign 0.00
R8455:Nipbl UTSW 15 8,364,528 (GRCm39) missense probably damaging 0.98
R8717:Nipbl UTSW 15 8,368,225 (GRCm39) missense probably benign
R8739:Nipbl UTSW 15 8,332,904 (GRCm39) missense probably benign 0.08
R8854:Nipbl UTSW 15 8,330,210 (GRCm39) missense probably damaging 1.00
R8887:Nipbl UTSW 15 8,391,271 (GRCm39) missense probably damaging 1.00
R8942:Nipbl UTSW 15 8,381,104 (GRCm39) missense probably benign
R8991:Nipbl UTSW 15 8,320,997 (GRCm39) missense probably damaging 1.00
R9008:Nipbl UTSW 15 8,356,608 (GRCm39) missense probably damaging 1.00
R9070:Nipbl UTSW 15 8,368,215 (GRCm39) missense possibly damaging 0.82
R9116:Nipbl UTSW 15 8,380,340 (GRCm39) missense probably benign 0.00
R9778:Nipbl UTSW 15 8,321,032 (GRCm39) missense probably benign 0.10
RF020:Nipbl UTSW 15 8,388,418 (GRCm39) missense probably damaging 0.98
X0022:Nipbl UTSW 15 8,381,199 (GRCm39) missense probably benign 0.05
X0027:Nipbl UTSW 15 8,353,021 (GRCm39) missense probably damaging 1.00
Z1088:Nipbl UTSW 15 8,337,366 (GRCm39) missense probably damaging 1.00
Z1176:Nipbl UTSW 15 8,368,183 (GRCm39) missense possibly damaging 0.88
Z1177:Nipbl UTSW 15 8,368,164 (GRCm39) critical splice donor site probably null
Z1177:Nipbl UTSW 15 8,366,436 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCATTCTTCTGTCAATGCACAC -3'
(R):5'- GACTTGTGTCATCCCTGCTG -3'

Sequencing Primer
(F):5'- CTGTCAATGCACACATAATTTTGG -3'
(R):5'- CGTGTGGTTTACAGAACTCTGAAAC -3'
Posted On 2022-09-12