Incidental Mutation 'R9622:Pdzrn4'
ID 724900
Institutional Source Beutler Lab
Gene Symbol Pdzrn4
Ensembl Gene ENSMUSG00000036218
Gene Name PDZ domain containing RING finger 4
Synonyms 1110017D07Rik, SAMCAP3L, LNX4
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R9622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 92294762-92669700 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92294949 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 52 (W52R)
Ref Sequence ENSEMBL: ENSMUSP00000133159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169942]
AlphaFold E9PUZ9
Predicted Effect probably benign
Transcript: ENSMUST00000169942
AA Change: W52R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: W52R

DomainStartEndE-ValueType
RING 22 56 1.38e-1 SMART
low complexity region 101 124 N/A INTRINSIC
PDZ 213 295 3.82e-20 SMART
PDZ 393 468 3.01e-18 SMART
low complexity region 479 498 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
coiled coil region 633 669 N/A INTRINSIC
low complexity region 802 816 N/A INTRINSIC
low complexity region 935 948 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 A G 5: 36,006,889 (GRCm39) K435E probably damaging Het
Acly T C 11: 100,395,785 (GRCm39) T412A probably damaging Het
Aldh3b2 T A 19: 4,029,489 (GRCm39) D287E probably benign Het
Asphd1 G A 7: 126,547,974 (GRCm39) P110S Het
Atg7 T C 6: 114,654,993 (GRCm39) L142P probably benign Het
Atp13a4 T C 16: 29,239,277 (GRCm39) I796V Het
Bbx A G 16: 50,095,022 (GRCm39) V98A probably damaging Het
Brca2 T C 5: 150,480,410 (GRCm39) S2727P probably damaging Het
Camk1 T A 6: 113,318,850 (GRCm39) D21V possibly damaging Het
Cdc5l A T 17: 45,715,709 (GRCm39) D634E probably benign Het
Cfap418 T C 4: 10,893,304 (GRCm39) I141T possibly damaging Het
Cyfip1 A T 7: 55,528,853 (GRCm39) D275V possibly damaging Het
Cyp4a30b A G 4: 115,328,162 (GRCm39) E477G probably damaging Het
Cyp4f16 C T 17: 32,769,246 (GRCm39) P379S probably damaging Het
Dchs2 C T 3: 83,263,766 (GRCm39) Q3345* probably null Het
Dnaaf1 A G 8: 120,315,001 (GRCm39) T270A possibly damaging Het
Dnah3 A G 7: 119,561,356 (GRCm39) V334A Het
Dnhd1 T C 7: 105,353,342 (GRCm39) F2832L probably benign Het
Dock8 A G 19: 25,098,545 (GRCm39) N623S probably null Het
Eif4enif1 T C 11: 3,165,714 (GRCm39) I97T probably benign Het
Elmo1 C G 13: 20,392,310 (GRCm39) P29A probably benign Het
Erich6 G C 3: 58,544,162 (GRCm39) P142A possibly damaging Het
Fam135b T C 15: 71,397,686 (GRCm39) R125G probably damaging Het
Fcrla T A 1: 170,749,808 (GRCm39) H83L probably damaging Het
Flt3 C T 5: 147,303,841 (GRCm39) E366K possibly damaging Het
Gabbr2 C T 4: 46,724,283 (GRCm39) probably null Het
Gigyf1 T A 5: 137,522,926 (GRCm39) L809* probably null Het
Glg1 C T 8: 111,899,133 (GRCm39) G711R probably damaging Het
Gp1bb T C 16: 18,439,527 (GRCm39) E189G probably benign Het
H2-Q1 A T 17: 35,542,532 (GRCm39) I326F probably benign Het
Hoxb3 A T 11: 96,235,420 (GRCm39) K116* probably null Het
Kcnb1 T C 2: 167,030,161 (GRCm39) Y128C probably damaging Het
Kif5b G A 18: 6,225,672 (GRCm39) R171C probably damaging Het
Lcn4 G A 2: 26,561,228 (GRCm39) Q18* probably null Het
Lrp1b G A 2: 40,779,354 (GRCm39) Q2677* probably null Het
Map4k3 T A 17: 80,958,538 (GRCm39) T145S probably damaging Het
Mas1 T C 17: 13,060,898 (GRCm39) E175G probably benign Het
Metap2 T C 10: 93,707,366 (GRCm39) T202A probably benign Het
Mras A T 9: 99,275,054 (GRCm39) M131K probably benign Het
Mtor T C 4: 148,568,169 (GRCm39) V1092A probably damaging Het
Mug2 T C 6: 122,028,751 (GRCm39) S582P probably benign Het
Myo5b A G 18: 74,848,017 (GRCm39) N1085S probably damaging Het
Nav3 T C 10: 109,603,103 (GRCm39) T1149A probably benign Het
Nipbl A T 15: 8,366,373 (GRCm39) S1239T probably benign Het
Nkpd1 C A 7: 19,257,867 (GRCm39) R549S probably benign Het
Or10a3m T A 7: 108,312,677 (GRCm39) M39K probably benign Het
Or10p1 G A 10: 129,444,084 (GRCm39) H89Y probably benign Het
Or1j1 A G 2: 36,702,621 (GRCm39) L161P probably damaging Het
Or51i2 T A 7: 103,689,522 (GRCm39) V173D probably damaging Het
Pcdh18 T C 3: 49,711,229 (GRCm39) N29D probably benign Het
Plekhb1 T C 7: 100,304,588 (GRCm39) K39E probably damaging Het
Pramel28 A G 4: 143,692,348 (GRCm39) S218P probably benign Het
Psmb4 C A 3: 94,792,285 (GRCm39) E212D probably benign Het
Rcc1l A G 5: 134,205,348 (GRCm39) L69P probably damaging Het
Robo2 T C 16: 73,729,952 (GRCm39) R1082G probably benign Het
Rorb T C 19: 18,955,115 (GRCm39) Y167C probably damaging Het
Sanbr T A 11: 23,534,590 (GRCm39) K589I probably damaging Het
Sbsn GGAAATATGGCAGACAAGTTTGGTCAGGGGGCCCACCATGCTTTTGGTCAGGGCAG GG 7: 30,452,067 (GRCm39) probably benign Het
Scaf8 T A 17: 3,248,170 (GRCm39) F1164L probably benign Het
Scn10a A T 9: 119,438,046 (GRCm39) M1940K probably benign Het
Serpinb2 A G 1: 107,452,298 (GRCm39) N292S probably benign Het
Sparcl1 C A 5: 104,234,998 (GRCm39) V506L possibly damaging Het
Stt3a A G 9: 36,661,025 (GRCm39) V262A possibly damaging Het
Syt17 C A 7: 118,036,191 (GRCm39) M58I probably benign Het
Tas2r134 A C 2: 51,518,358 (GRCm39) N279T possibly damaging Het
Tbc1d2 T C 4: 46,609,065 (GRCm39) E724G probably damaging Het
Teddm1b T A 1: 153,750,620 (GRCm39) L143Q Het
Tlk1 T A 2: 70,617,281 (GRCm39) R66S probably damaging Het
Tmem139 A T 6: 42,240,176 (GRCm39) probably null Het
Tom1l2 T C 11: 60,151,942 (GRCm39) Y155C possibly damaging Het
Trmt1l C A 1: 151,304,710 (GRCm39) S28* probably null Het
Ttf2 T C 3: 100,859,918 (GRCm39) I679V probably benign Het
Unc13b T G 4: 43,172,513 (GRCm39) F1114V Het
Vmn2r25 T A 6: 123,816,579 (GRCm39) D334V probably damaging Het
Vps13c T G 9: 67,856,715 (GRCm39) Y2581D probably damaging Het
Xkr5 A G 8: 18,984,247 (GRCm39) S432P probably benign Het
Zc2hc1b G A 10: 13,043,677 (GRCm39) P73S possibly damaging Het
Zfhx2 A C 14: 55,303,483 (GRCm39) F1500L probably benign Het
Zfp3 T G 11: 70,662,739 (GRCm39) S233A possibly damaging Het
Zmat5 T C 11: 4,687,453 (GRCm39) W169R probably damaging Het
Other mutations in Pdzrn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Pdzrn4 APN 15 92,644,159 (GRCm39) missense probably damaging 1.00
IGL01991:Pdzrn4 APN 15 92,299,807 (GRCm39) splice site probably null
IGL02103:Pdzrn4 APN 15 92,667,768 (GRCm39) missense probably damaging 1.00
IGL02243:Pdzrn4 APN 15 92,668,577 (GRCm39) missense probably benign 0.30
IGL02269:Pdzrn4 APN 15 92,667,731 (GRCm39) missense probably damaging 1.00
IGL03005:Pdzrn4 APN 15 92,668,272 (GRCm39) missense probably damaging 1.00
PIT4362001:Pdzrn4 UTSW 15 92,667,762 (GRCm39) missense possibly damaging 0.46
R0243:Pdzrn4 UTSW 15 92,668,200 (GRCm39) missense possibly damaging 0.46
R0367:Pdzrn4 UTSW 15 92,655,538 (GRCm39) missense possibly damaging 0.53
R0972:Pdzrn4 UTSW 15 92,655,592 (GRCm39) missense probably benign 0.00
R1168:Pdzrn4 UTSW 15 92,668,152 (GRCm39) missense probably benign 0.16
R1411:Pdzrn4 UTSW 15 92,668,894 (GRCm39) makesense probably null
R1466:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1466:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1489:Pdzrn4 UTSW 15 92,575,593 (GRCm39) missense probably benign
R1503:Pdzrn4 UTSW 15 92,297,685 (GRCm39) missense probably damaging 0.99
R1561:Pdzrn4 UTSW 15 92,575,518 (GRCm39) missense possibly damaging 0.84
R1584:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1733:Pdzrn4 UTSW 15 92,299,855 (GRCm39) missense probably benign 0.06
R1965:Pdzrn4 UTSW 15 92,644,190 (GRCm39) splice site probably null
R2061:Pdzrn4 UTSW 15 92,668,041 (GRCm39) missense probably damaging 0.99
R3010:Pdzrn4 UTSW 15 92,667,692 (GRCm39) missense probably benign 0.32
R4016:Pdzrn4 UTSW 15 92,297,630 (GRCm39) missense probably benign
R4032:Pdzrn4 UTSW 15 92,667,414 (GRCm39) missense probably damaging 1.00
R4110:Pdzrn4 UTSW 15 92,668,745 (GRCm39) missense probably benign 0.26
R4180:Pdzrn4 UTSW 15 92,299,898 (GRCm39) missense possibly damaging 0.93
R4539:Pdzrn4 UTSW 15 92,668,470 (GRCm39) missense probably damaging 1.00
R4617:Pdzrn4 UTSW 15 92,667,723 (GRCm39) missense probably damaging 1.00
R4734:Pdzrn4 UTSW 15 92,668,133 (GRCm39) nonsense probably null
R4900:Pdzrn4 UTSW 15 92,668,638 (GRCm39) missense probably damaging 1.00
R5422:Pdzrn4 UTSW 15 92,575,502 (GRCm39) missense probably benign 0.01
R5444:Pdzrn4 UTSW 15 92,668,806 (GRCm39) missense probably damaging 1.00
R5772:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R5775:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R5935:Pdzrn4 UTSW 15 92,295,255 (GRCm39) missense probably benign 0.01
R6192:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6210:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6258:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6259:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6391:Pdzrn4 UTSW 15 92,578,418 (GRCm39) missense probably damaging 0.99
R6613:Pdzrn4 UTSW 15 92,575,455 (GRCm39) missense probably damaging 0.99
R7046:Pdzrn4 UTSW 15 92,668,303 (GRCm39) nonsense probably null
R7096:Pdzrn4 UTSW 15 92,295,384 (GRCm39) missense probably benign 0.00
R7451:Pdzrn4 UTSW 15 92,667,948 (GRCm39) missense possibly damaging 0.68
R8075:Pdzrn4 UTSW 15 92,575,605 (GRCm39) missense probably damaging 0.99
R8125:Pdzrn4 UTSW 15 92,641,476 (GRCm39) missense probably damaging 1.00
R8324:Pdzrn4 UTSW 15 92,668,818 (GRCm39) missense probably damaging 1.00
R9332:Pdzrn4 UTSW 15 92,295,216 (GRCm39) missense probably benign
R9555:Pdzrn4 UTSW 15 92,297,703 (GRCm39) missense probably damaging 1.00
R9558:Pdzrn4 UTSW 15 92,299,877 (GRCm39) missense possibly damaging 0.46
R9763:Pdzrn4 UTSW 15 92,668,376 (GRCm39) missense probably damaging 1.00
R9796:Pdzrn4 UTSW 15 92,578,353 (GRCm39) missense possibly damaging 0.93
X0018:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0020:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0021:Pdzrn4 UTSW 15 92,575,590 (GRCm39) missense probably damaging 1.00
X0026:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92,578,393 (GRCm39) missense possibly damaging 0.92
X0027:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0065:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
Z1176:Pdzrn4 UTSW 15 92,294,838 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCACAGCTTTGAAACTCCAAG -3'
(R):5'- GATACCTGCGCTGCAACAAG -3'

Sequencing Primer
(F):5'- GCCAAACTTATTCTGAGCTCAC -3'
(R):5'- GCTGCAACAAGCTGACCTG -3'
Posted On 2022-09-12