Incidental Mutation 'R9622:Atp13a4'
ID 724902
Institutional Source Beutler Lab
Gene Symbol Atp13a4
Ensembl Gene ENSMUSG00000038094
Gene Name ATPase type 13A4
Synonyms 9330174J19Rik, 4631413J11Rik
Accession Numbers

Genbank: NM_001164612, NM_172613, NM_001164613

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 29395853-29544864 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 29420459 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 796 (I796V)
Ref Sequence ENSEMBL: ENSMUSP00000060987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039090] [ENSMUST00000057018] [ENSMUST00000182013] [ENSMUST00000182627]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039090
SMART Domains Protein: ENSMUSP00000048753
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 8.4e-31 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 1.7e-36 PFAM
Pfam:Hydrolase 481 769 3.9e-11 PFAM
Pfam:HAD 484 787 4.1e-14 PFAM
Pfam:Hydrolase_like2 574 637 1.2e-9 PFAM
transmembrane domain 824 846 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000060987
Gene: ENSMUSG00000038094
AA Change: I796V

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 9.6e-34 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 228 476 1.6e-34 PFAM
Pfam:Hydrolase 481 767 1.1e-10 PFAM
Pfam:HAD 484 858 3.3e-23 PFAM
Pfam:Cation_ATPase 573 637 4.9e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182013
SMART Domains Protein: ENSMUSP00000138583
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 84 4.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182168
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000182627
AA Change: I815V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000138479
Gene: ENSMUSG00000038094
AA Change: I815V

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 2.1e-29 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 3.9e-35 PFAM
Pfam:Hydrolase 481 861 4.2e-16 PFAM
Pfam:HAD 484 858 1.9e-23 PFAM
Pfam:Hydrolase_like2 574 637 2.2e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T A 11: 23,584,590 K589I probably damaging Het
2610301B20Rik T C 4: 10,893,304 I141T possibly damaging Het
Ablim2 A G 5: 35,849,545 K435E probably damaging Het
Acly T C 11: 100,504,959 T412A probably damaging Het
Aldh3b2 T A 19: 3,979,489 D287E probably benign Het
Asphd1 G A 7: 126,948,802 P110S Het
Atg7 T C 6: 114,678,032 L142P probably benign Het
Bbx A G 16: 50,274,659 V98A probably damaging Het
Brca2 T C 5: 150,556,945 S2727P probably damaging Het
Camk1 T A 6: 113,341,889 D21V possibly damaging Het
Cdc5l A T 17: 45,404,783 D634E probably benign Het
Cyfip1 A T 7: 55,879,105 D275V possibly damaging Het
Cyp4a30b A G 4: 115,470,965 E477G probably damaging Het
Cyp4f16 C T 17: 32,550,272 P379S probably damaging Het
Dchs2 C T 3: 83,356,459 Q3345* probably null Het
Dnaaf1 A G 8: 119,588,262 T270A possibly damaging Het
Dnah3 A G 7: 119,962,133 V334A Het
Dnhd1 T C 7: 105,704,135 F2832L probably benign Het
Dock8 A G 19: 25,121,181 N623S probably null Het
Eif4enif1 T C 11: 3,215,714 I97T probably benign Het
Elmo1 C G 13: 20,208,140 P29A probably benign Het
Erich6 G C 3: 58,636,741 P142A possibly damaging Het
Fam135b T C 15: 71,525,837 R125G probably damaging Het
Fcrla T A 1: 170,922,239 H83L probably damaging Het
Flt3 C T 5: 147,367,031 E366K possibly damaging Het
Gabbr2 C T 4: 46,724,283 probably null Het
Gigyf1 T A 5: 137,524,664 L809* probably null Het
Glg1 C T 8: 111,172,501 G711R probably damaging Het
Gm13101 A G 4: 143,965,778 S218P probably benign Het
Gp1bb T C 16: 18,620,777 E189G probably benign Het
H2-Q1 A T 17: 35,323,556 I326F probably benign Het
Hoxb3 A T 11: 96,344,594 K116* probably null Het
Kcnb1 T C 2: 167,188,241 Y128C probably damaging Het
Kif5b G A 18: 6,225,672 R171C probably damaging Het
Lcn4 G A 2: 26,671,216 Q18* probably null Het
Lrp1b G A 2: 40,889,342 Q2677* probably null Het
Map4k3 T A 17: 80,651,109 T145S probably damaging Het
Mas1 T C 17: 12,842,011 E175G probably benign Het
Metap2 T C 10: 93,871,504 T202A probably benign Het
Mras A T 9: 99,393,001 M131K probably benign Het
Mtor T C 4: 148,483,712 V1092A probably damaging Het
Mug2 T C 6: 122,051,792 S582P probably benign Het
Myo5b A G 18: 74,714,946 N1085S probably damaging Het
Nav3 T C 10: 109,767,242 T1149A probably benign Het
Nipbl A T 15: 8,336,889 S1239T probably benign Het
Nkpd1 C A 7: 19,523,942 R549S probably benign Het
Olfr3 A G 2: 36,812,609 L161P probably damaging Het
Olfr512 T A 7: 108,713,470 M39K probably benign Het
Olfr641 T A 7: 104,040,315 V173D probably damaging Het
Olfr796 G A 10: 129,608,215 H89Y probably benign Het
Pcdh18 T C 3: 49,756,780 N29D probably benign Het
Pdzrn4 T C 15: 92,397,068 W52R probably benign Het
Plekhb1 T C 7: 100,655,381 K39E probably damaging Het
Psmb4 C A 3: 94,884,974 E212D probably benign Het
Rcc1l A G 5: 134,176,509 L69P probably damaging Het
Robo2 T C 16: 73,933,064 R1082G probably benign Het
Rorb T C 19: 18,977,751 Y167C probably damaging Het
Sbsn GGAAATATGGCAGACAAGTTTGGTCAGGGGGCCCACCATGCTTTTGGTCAGGGCAG GG 7: 30,752,642 probably benign Het
Scaf8 T A 17: 3,197,895 F1164L probably benign Het
Scn10a A T 9: 119,608,980 M1940K probably benign Het
Serpinb2 A G 1: 107,524,568 N292S probably benign Het
Sparcl1 C A 5: 104,087,132 V506L possibly damaging Het
Stt3a A G 9: 36,749,729 V262A possibly damaging Het
Syt17 C A 7: 118,436,968 M58I probably benign Het
Tas2r134 A C 2: 51,628,346 N279T possibly damaging Het
Tbc1d2 T C 4: 46,609,065 E724G probably damaging Het
Teddm1b T A 1: 153,874,874 L143Q Het
Tlk1 T A 2: 70,786,937 R66S probably damaging Het
Tmem139 A T 6: 42,263,242 probably null Het
Tom1l2 T C 11: 60,261,116 Y155C possibly damaging Het
Trmt1l C A 1: 151,428,959 S28* probably null Het
Ttf2 T C 3: 100,952,602 I679V probably benign Het
Unc13b T G 4: 43,172,513 F1114V Het
Vmn2r25 T A 6: 123,839,620 D334V probably damaging Het
Vps13c T G 9: 67,949,433 Y2581D probably damaging Het
Xkr5 A G 8: 18,934,231 S432P probably benign Het
Zc2hc1b G A 10: 13,167,933 P73S possibly damaging Het
Zfhx2 A C 14: 55,066,026 F1500L probably benign Het
Zfp3 T G 11: 70,771,913 S233A possibly damaging Het
Zmat5 T C 11: 4,737,453 W169R probably damaging Het
Other mutations in Atp13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Atp13a4 APN 16 29403778 splice site probably benign
IGL01577:Atp13a4 APN 16 29441284 missense possibly damaging 0.77
IGL01834:Atp13a4 APN 16 29415777 splice site probably benign
IGL02165:Atp13a4 APN 16 29434010 missense probably damaging 1.00
IGL02194:Atp13a4 APN 16 29456629 missense probably damaging 1.00
IGL02322:Atp13a4 APN 16 29440102 missense probably benign 0.00
IGL02553:Atp13a4 APN 16 29422703 missense probably benign 0.03
IGL02821:Atp13a4 APN 16 29441307 missense probably benign 0.01
IGL03349:Atp13a4 APN 16 29456671 missense probably benign 0.01
G5030:Atp13a4 UTSW 16 29455488 missense probably damaging 1.00
R0091:Atp13a4 UTSW 16 29455395 missense probably damaging 1.00
R0100:Atp13a4 UTSW 16 29421724 missense probably damaging 1.00
R0278:Atp13a4 UTSW 16 29454834 missense probably damaging 1.00
R1263:Atp13a4 UTSW 16 29471953 missense possibly damaging 0.60
R1378:Atp13a4 UTSW 16 29420428 missense probably damaging 1.00
R1575:Atp13a4 UTSW 16 29409710 missense probably benign 0.01
R1720:Atp13a4 UTSW 16 29408928 missense probably damaging 0.99
R1759:Atp13a4 UTSW 16 29456611 missense probably damaging 0.99
R1967:Atp13a4 UTSW 16 29479854 missense probably damaging 0.99
R2030:Atp13a4 UTSW 16 29422684 missense probably damaging 1.00
R2113:Atp13a4 UTSW 16 29441284 missense possibly damaging 0.77
R3409:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R3410:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R4032:Atp13a4 UTSW 16 29418571 missense probably damaging 1.00
R4163:Atp13a4 UTSW 16 29541250 missense possibly damaging 0.87
R4652:Atp13a4 UTSW 16 29452603 missense probably damaging 1.00
R4772:Atp13a4 UTSW 16 29420835 intron probably benign
R4795:Atp13a4 UTSW 16 29490008 critical splice donor site probably null
R4898:Atp13a4 UTSW 16 29408961 nonsense probably null
R4996:Atp13a4 UTSW 16 29472004 missense probably damaging 1.00
R5112:Atp13a4 UTSW 16 29409868 missense possibly damaging 0.87
R5259:Atp13a4 UTSW 16 29456610 missense probably damaging 1.00
R5395:Atp13a4 UTSW 16 29420888 nonsense probably null
R5395:Atp13a4 UTSW 16 29456604 missense possibly damaging 0.94
R5640:Atp13a4 UTSW 16 29415831 missense probably damaging 0.98
R5809:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.56
R5856:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.94
R5912:Atp13a4 UTSW 16 29456571 missense probably benign 0.33
R6282:Atp13a4 UTSW 16 29434004 missense probably benign 0.00
R6404:Atp13a4 UTSW 16 29471901 nonsense probably null
R6497:Atp13a4 UTSW 16 29479901 missense probably damaging 1.00
R6577:Atp13a4 UTSW 16 29479841 missense probably benign 0.03
R6806:Atp13a4 UTSW 16 29469280 missense probably damaging 1.00
R7229:Atp13a4 UTSW 16 29420905 missense probably benign 0.05
R7438:Atp13a4 UTSW 16 29441196 missense
R7493:Atp13a4 UTSW 16 29471956 missense
R7712:Atp13a4 UTSW 16 29459487 missense
R7739:Atp13a4 UTSW 16 29456601 missense
R7897:Atp13a4 UTSW 16 29396466 missense
R7950:Atp13a4 UTSW 16 29449917 missense
R8217:Atp13a4 UTSW 16 29403801 missense
R8227:Atp13a4 UTSW 16 29403845 missense
R8273:Atp13a4 UTSW 16 29471902 missense
R8488:Atp13a4 UTSW 16 29417836 missense possibly damaging 0.63
R8508:Atp13a4 UTSW 16 29454769 nonsense probably null
R8773:Atp13a4 UTSW 16 29441580 missense
R8921:Atp13a4 UTSW 16 29454774 missense
R8940:Atp13a4 UTSW 16 29454690 critical splice donor site probably null
R9056:Atp13a4 UTSW 16 29471888 critical splice donor site probably null
R9272:Atp13a4 UTSW 16 29449979 missense
R9292:Atp13a4 UTSW 16 29422682 missense
R9415:Atp13a4 UTSW 16 29409003 missense
R9453:Atp13a4 UTSW 16 29420841 missense unknown
R9497:Atp13a4 UTSW 16 29469312 critical splice acceptor site probably null
R9541:Atp13a4 UTSW 16 29422726 missense
R9614:Atp13a4 UTSW 16 29441580 missense
R9727:Atp13a4 UTSW 16 29409771 missense
Z1176:Atp13a4 UTSW 16 29422587 missense probably null
Predicted Primers PCR Primer
(F):5'- TCCATCTCGGTTACTACGTGAGG -3'
(R):5'- CTGGGTTCAATTACACAGGGC -3'

Sequencing Primer
(F):5'- GTGAGGCCTCCATTAATTCAAGC -3'
(R):5'- CAGGAAAAGGAGGAGGCAG -3'
Posted On 2022-09-12