Incidental Mutation 'R9622:Atp13a4'
ID 724902
Institutional Source Beutler Lab
Gene Symbol Atp13a4
Ensembl Gene ENSMUSG00000038094
Gene Name ATPase type 13A4
Synonyms 4631413J11Rik, 9330174J19Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 29214671-29363682 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 29239277 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 796 (I796V)
Ref Sequence ENSEMBL: ENSMUSP00000060987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039090] [ENSMUST00000057018] [ENSMUST00000182013] [ENSMUST00000182627]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039090
SMART Domains Protein: ENSMUSP00000048753
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 8.4e-31 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 1.7e-36 PFAM
Pfam:Hydrolase 481 769 3.9e-11 PFAM
Pfam:HAD 484 787 4.1e-14 PFAM
Pfam:Hydrolase_like2 574 637 1.2e-9 PFAM
transmembrane domain 824 846 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000060987
Gene: ENSMUSG00000038094
AA Change: I796V

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 9.6e-34 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 228 476 1.6e-34 PFAM
Pfam:Hydrolase 481 767 1.1e-10 PFAM
Pfam:HAD 484 858 3.3e-23 PFAM
Pfam:Cation_ATPase 573 637 4.9e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182013
SMART Domains Protein: ENSMUSP00000138583
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 84 4.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182168
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000182627
AA Change: I815V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000138479
Gene: ENSMUSG00000038094
AA Change: I815V

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 2.1e-29 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 3.9e-35 PFAM
Pfam:Hydrolase 481 861 4.2e-16 PFAM
Pfam:HAD 484 858 1.9e-23 PFAM
Pfam:Hydrolase_like2 574 637 2.2e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 A G 5: 36,006,889 (GRCm39) K435E probably damaging Het
Acly T C 11: 100,395,785 (GRCm39) T412A probably damaging Het
Aldh3b2 T A 19: 4,029,489 (GRCm39) D287E probably benign Het
Asphd1 G A 7: 126,547,974 (GRCm39) P110S Het
Atg7 T C 6: 114,654,993 (GRCm39) L142P probably benign Het
Bbx A G 16: 50,095,022 (GRCm39) V98A probably damaging Het
Brca2 T C 5: 150,480,410 (GRCm39) S2727P probably damaging Het
Camk1 T A 6: 113,318,850 (GRCm39) D21V possibly damaging Het
Cdc5l A T 17: 45,715,709 (GRCm39) D634E probably benign Het
Cfap418 T C 4: 10,893,304 (GRCm39) I141T possibly damaging Het
Cyfip1 A T 7: 55,528,853 (GRCm39) D275V possibly damaging Het
Cyp4a30b A G 4: 115,328,162 (GRCm39) E477G probably damaging Het
Cyp4f16 C T 17: 32,769,246 (GRCm39) P379S probably damaging Het
Dchs2 C T 3: 83,263,766 (GRCm39) Q3345* probably null Het
Dnaaf1 A G 8: 120,315,001 (GRCm39) T270A possibly damaging Het
Dnah3 A G 7: 119,561,356 (GRCm39) V334A Het
Dnhd1 T C 7: 105,353,342 (GRCm39) F2832L probably benign Het
Dock8 A G 19: 25,098,545 (GRCm39) N623S probably null Het
Eif4enif1 T C 11: 3,165,714 (GRCm39) I97T probably benign Het
Elmo1 C G 13: 20,392,310 (GRCm39) P29A probably benign Het
Erich6 G C 3: 58,544,162 (GRCm39) P142A possibly damaging Het
Fam135b T C 15: 71,397,686 (GRCm39) R125G probably damaging Het
Fcrla T A 1: 170,749,808 (GRCm39) H83L probably damaging Het
Flt3 C T 5: 147,303,841 (GRCm39) E366K possibly damaging Het
Gabbr2 C T 4: 46,724,283 (GRCm39) probably null Het
Gigyf1 T A 5: 137,522,926 (GRCm39) L809* probably null Het
Glg1 C T 8: 111,899,133 (GRCm39) G711R probably damaging Het
Gp1bb T C 16: 18,439,527 (GRCm39) E189G probably benign Het
H2-Q1 A T 17: 35,542,532 (GRCm39) I326F probably benign Het
Hoxb3 A T 11: 96,235,420 (GRCm39) K116* probably null Het
Kcnb1 T C 2: 167,030,161 (GRCm39) Y128C probably damaging Het
Kif5b G A 18: 6,225,672 (GRCm39) R171C probably damaging Het
Lcn4 G A 2: 26,561,228 (GRCm39) Q18* probably null Het
Lrp1b G A 2: 40,779,354 (GRCm39) Q2677* probably null Het
Map4k3 T A 17: 80,958,538 (GRCm39) T145S probably damaging Het
Mas1 T C 17: 13,060,898 (GRCm39) E175G probably benign Het
Metap2 T C 10: 93,707,366 (GRCm39) T202A probably benign Het
Mras A T 9: 99,275,054 (GRCm39) M131K probably benign Het
Mtor T C 4: 148,568,169 (GRCm39) V1092A probably damaging Het
Mug2 T C 6: 122,028,751 (GRCm39) S582P probably benign Het
Myo5b A G 18: 74,848,017 (GRCm39) N1085S probably damaging Het
Nav3 T C 10: 109,603,103 (GRCm39) T1149A probably benign Het
Nipbl A T 15: 8,366,373 (GRCm39) S1239T probably benign Het
Nkpd1 C A 7: 19,257,867 (GRCm39) R549S probably benign Het
Or10a3m T A 7: 108,312,677 (GRCm39) M39K probably benign Het
Or10p1 G A 10: 129,444,084 (GRCm39) H89Y probably benign Het
Or1j1 A G 2: 36,702,621 (GRCm39) L161P probably damaging Het
Or51i2 T A 7: 103,689,522 (GRCm39) V173D probably damaging Het
Pcdh18 T C 3: 49,711,229 (GRCm39) N29D probably benign Het
Pdzrn4 T C 15: 92,294,949 (GRCm39) W52R probably benign Het
Plekhb1 T C 7: 100,304,588 (GRCm39) K39E probably damaging Het
Pramel28 A G 4: 143,692,348 (GRCm39) S218P probably benign Het
Psmb4 C A 3: 94,792,285 (GRCm39) E212D probably benign Het
Rcc1l A G 5: 134,205,348 (GRCm39) L69P probably damaging Het
Robo2 T C 16: 73,729,952 (GRCm39) R1082G probably benign Het
Rorb T C 19: 18,955,115 (GRCm39) Y167C probably damaging Het
Sanbr T A 11: 23,534,590 (GRCm39) K589I probably damaging Het
Sbsn GGAAATATGGCAGACAAGTTTGGTCAGGGGGCCCACCATGCTTTTGGTCAGGGCAG GG 7: 30,452,067 (GRCm39) probably benign Het
Scaf8 T A 17: 3,248,170 (GRCm39) F1164L probably benign Het
Scn10a A T 9: 119,438,046 (GRCm39) M1940K probably benign Het
Serpinb2 A G 1: 107,452,298 (GRCm39) N292S probably benign Het
Sparcl1 C A 5: 104,234,998 (GRCm39) V506L possibly damaging Het
Stt3a A G 9: 36,661,025 (GRCm39) V262A possibly damaging Het
Syt17 C A 7: 118,036,191 (GRCm39) M58I probably benign Het
Tas2r134 A C 2: 51,518,358 (GRCm39) N279T possibly damaging Het
Tbc1d2 T C 4: 46,609,065 (GRCm39) E724G probably damaging Het
Teddm1b T A 1: 153,750,620 (GRCm39) L143Q Het
Tlk1 T A 2: 70,617,281 (GRCm39) R66S probably damaging Het
Tmem139 A T 6: 42,240,176 (GRCm39) probably null Het
Tom1l2 T C 11: 60,151,942 (GRCm39) Y155C possibly damaging Het
Trmt1l C A 1: 151,304,710 (GRCm39) S28* probably null Het
Ttf2 T C 3: 100,859,918 (GRCm39) I679V probably benign Het
Unc13b T G 4: 43,172,513 (GRCm39) F1114V Het
Vmn2r25 T A 6: 123,816,579 (GRCm39) D334V probably damaging Het
Vps13c T G 9: 67,856,715 (GRCm39) Y2581D probably damaging Het
Xkr5 A G 8: 18,984,247 (GRCm39) S432P probably benign Het
Zc2hc1b G A 10: 13,043,677 (GRCm39) P73S possibly damaging Het
Zfhx2 A C 14: 55,303,483 (GRCm39) F1500L probably benign Het
Zfp3 T G 11: 70,662,739 (GRCm39) S233A possibly damaging Het
Zmat5 T C 11: 4,687,453 (GRCm39) W169R probably damaging Het
Other mutations in Atp13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Atp13a4 APN 16 29,222,596 (GRCm39) splice site probably benign
IGL01577:Atp13a4 APN 16 29,260,102 (GRCm39) missense possibly damaging 0.77
IGL01834:Atp13a4 APN 16 29,234,595 (GRCm39) splice site probably benign
IGL02165:Atp13a4 APN 16 29,252,828 (GRCm39) missense probably damaging 1.00
IGL02194:Atp13a4 APN 16 29,275,447 (GRCm39) missense probably damaging 1.00
IGL02322:Atp13a4 APN 16 29,258,920 (GRCm39) missense probably benign 0.00
IGL02553:Atp13a4 APN 16 29,241,521 (GRCm39) missense probably benign 0.03
IGL02821:Atp13a4 APN 16 29,260,125 (GRCm39) missense probably benign 0.01
IGL03349:Atp13a4 APN 16 29,275,489 (GRCm39) missense probably benign 0.01
G5030:Atp13a4 UTSW 16 29,274,306 (GRCm39) missense probably damaging 1.00
R0091:Atp13a4 UTSW 16 29,274,213 (GRCm39) missense probably damaging 1.00
R0100:Atp13a4 UTSW 16 29,240,542 (GRCm39) missense probably damaging 1.00
R0278:Atp13a4 UTSW 16 29,273,652 (GRCm39) missense probably damaging 1.00
R1263:Atp13a4 UTSW 16 29,290,771 (GRCm39) missense possibly damaging 0.60
R1378:Atp13a4 UTSW 16 29,239,246 (GRCm39) missense probably damaging 1.00
R1575:Atp13a4 UTSW 16 29,228,528 (GRCm39) missense probably benign 0.01
R1720:Atp13a4 UTSW 16 29,227,746 (GRCm39) missense probably damaging 0.99
R1759:Atp13a4 UTSW 16 29,275,429 (GRCm39) missense probably damaging 0.99
R1967:Atp13a4 UTSW 16 29,298,672 (GRCm39) missense probably damaging 0.99
R2030:Atp13a4 UTSW 16 29,241,502 (GRCm39) missense probably damaging 1.00
R2113:Atp13a4 UTSW 16 29,260,102 (GRCm39) missense possibly damaging 0.77
R3409:Atp13a4 UTSW 16 29,232,567 (GRCm39) missense probably damaging 1.00
R3410:Atp13a4 UTSW 16 29,232,567 (GRCm39) missense probably damaging 1.00
R4032:Atp13a4 UTSW 16 29,237,389 (GRCm39) missense probably damaging 1.00
R4163:Atp13a4 UTSW 16 29,360,068 (GRCm39) missense possibly damaging 0.87
R4652:Atp13a4 UTSW 16 29,271,421 (GRCm39) missense probably damaging 1.00
R4772:Atp13a4 UTSW 16 29,239,653 (GRCm39) intron probably benign
R4795:Atp13a4 UTSW 16 29,308,826 (GRCm39) critical splice donor site probably null
R4898:Atp13a4 UTSW 16 29,227,779 (GRCm39) nonsense probably null
R4996:Atp13a4 UTSW 16 29,290,822 (GRCm39) missense probably damaging 1.00
R5112:Atp13a4 UTSW 16 29,228,686 (GRCm39) missense possibly damaging 0.87
R5259:Atp13a4 UTSW 16 29,275,428 (GRCm39) missense probably damaging 1.00
R5395:Atp13a4 UTSW 16 29,275,422 (GRCm39) missense possibly damaging 0.94
R5395:Atp13a4 UTSW 16 29,239,706 (GRCm39) nonsense probably null
R5640:Atp13a4 UTSW 16 29,234,649 (GRCm39) missense probably damaging 0.98
R5809:Atp13a4 UTSW 16 29,252,805 (GRCm39) missense possibly damaging 0.56
R5856:Atp13a4 UTSW 16 29,252,805 (GRCm39) missense possibly damaging 0.94
R5912:Atp13a4 UTSW 16 29,275,389 (GRCm39) missense probably benign 0.33
R6282:Atp13a4 UTSW 16 29,252,822 (GRCm39) missense probably benign 0.00
R6404:Atp13a4 UTSW 16 29,290,719 (GRCm39) nonsense probably null
R6497:Atp13a4 UTSW 16 29,298,719 (GRCm39) missense probably damaging 1.00
R6577:Atp13a4 UTSW 16 29,298,659 (GRCm39) missense probably benign 0.03
R6806:Atp13a4 UTSW 16 29,288,098 (GRCm39) missense probably damaging 1.00
R7229:Atp13a4 UTSW 16 29,239,723 (GRCm39) missense probably benign 0.05
R7438:Atp13a4 UTSW 16 29,260,014 (GRCm39) missense
R7493:Atp13a4 UTSW 16 29,290,774 (GRCm39) missense
R7712:Atp13a4 UTSW 16 29,278,305 (GRCm39) missense
R7739:Atp13a4 UTSW 16 29,275,419 (GRCm39) missense
R7897:Atp13a4 UTSW 16 29,215,284 (GRCm39) missense
R7950:Atp13a4 UTSW 16 29,268,735 (GRCm39) missense
R8217:Atp13a4 UTSW 16 29,222,619 (GRCm39) missense
R8227:Atp13a4 UTSW 16 29,222,663 (GRCm39) missense
R8273:Atp13a4 UTSW 16 29,290,720 (GRCm39) missense
R8488:Atp13a4 UTSW 16 29,236,654 (GRCm39) missense possibly damaging 0.63
R8508:Atp13a4 UTSW 16 29,273,587 (GRCm39) nonsense probably null
R8773:Atp13a4 UTSW 16 29,260,398 (GRCm39) missense
R8921:Atp13a4 UTSW 16 29,273,592 (GRCm39) missense
R8940:Atp13a4 UTSW 16 29,273,508 (GRCm39) critical splice donor site probably null
R9056:Atp13a4 UTSW 16 29,290,706 (GRCm39) critical splice donor site probably null
R9272:Atp13a4 UTSW 16 29,268,797 (GRCm39) missense
R9292:Atp13a4 UTSW 16 29,241,500 (GRCm39) missense
R9415:Atp13a4 UTSW 16 29,227,821 (GRCm39) missense
R9453:Atp13a4 UTSW 16 29,239,659 (GRCm39) missense unknown
R9497:Atp13a4 UTSW 16 29,288,130 (GRCm39) critical splice acceptor site probably null
R9541:Atp13a4 UTSW 16 29,241,544 (GRCm39) missense
R9614:Atp13a4 UTSW 16 29,260,398 (GRCm39) missense
R9727:Atp13a4 UTSW 16 29,228,589 (GRCm39) missense
Z1176:Atp13a4 UTSW 16 29,241,405 (GRCm39) missense probably null
Predicted Primers PCR Primer
(F):5'- TCCATCTCGGTTACTACGTGAGG -3'
(R):5'- CTGGGTTCAATTACACAGGGC -3'

Sequencing Primer
(F):5'- GTGAGGCCTCCATTAATTCAAGC -3'
(R):5'- CAGGAAAAGGAGGAGGCAG -3'
Posted On 2022-09-12