Incidental Mutation 'R9622:Dock8'
ID 724915
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Name dedicator of cytokinesis 8
Synonyms 1200017A24Rik, 5830472H07Rik, A130095G14Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R9622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 24976898-25179796 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25098545 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 623 (N623S)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
AlphaFold Q8C147
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000025831
AA Change: N623S
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: N623S

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 A G 5: 36,006,889 (GRCm39) K435E probably damaging Het
Acly T C 11: 100,395,785 (GRCm39) T412A probably damaging Het
Aldh3b2 T A 19: 4,029,489 (GRCm39) D287E probably benign Het
Asphd1 G A 7: 126,547,974 (GRCm39) P110S Het
Atg7 T C 6: 114,654,993 (GRCm39) L142P probably benign Het
Atp13a4 T C 16: 29,239,277 (GRCm39) I796V Het
Bbx A G 16: 50,095,022 (GRCm39) V98A probably damaging Het
Brca2 T C 5: 150,480,410 (GRCm39) S2727P probably damaging Het
Camk1 T A 6: 113,318,850 (GRCm39) D21V possibly damaging Het
Cdc5l A T 17: 45,715,709 (GRCm39) D634E probably benign Het
Cfap418 T C 4: 10,893,304 (GRCm39) I141T possibly damaging Het
Cyfip1 A T 7: 55,528,853 (GRCm39) D275V possibly damaging Het
Cyp4a30b A G 4: 115,328,162 (GRCm39) E477G probably damaging Het
Cyp4f16 C T 17: 32,769,246 (GRCm39) P379S probably damaging Het
Dchs2 C T 3: 83,263,766 (GRCm39) Q3345* probably null Het
Dnaaf1 A G 8: 120,315,001 (GRCm39) T270A possibly damaging Het
Dnah3 A G 7: 119,561,356 (GRCm39) V334A Het
Dnhd1 T C 7: 105,353,342 (GRCm39) F2832L probably benign Het
Eif4enif1 T C 11: 3,165,714 (GRCm39) I97T probably benign Het
Elmo1 C G 13: 20,392,310 (GRCm39) P29A probably benign Het
Erich6 G C 3: 58,544,162 (GRCm39) P142A possibly damaging Het
Fam135b T C 15: 71,397,686 (GRCm39) R125G probably damaging Het
Fcrla T A 1: 170,749,808 (GRCm39) H83L probably damaging Het
Flt3 C T 5: 147,303,841 (GRCm39) E366K possibly damaging Het
Gabbr2 C T 4: 46,724,283 (GRCm39) probably null Het
Gigyf1 T A 5: 137,522,926 (GRCm39) L809* probably null Het
Glg1 C T 8: 111,899,133 (GRCm39) G711R probably damaging Het
Gp1bb T C 16: 18,439,527 (GRCm39) E189G probably benign Het
H2-Q1 A T 17: 35,542,532 (GRCm39) I326F probably benign Het
Hoxb3 A T 11: 96,235,420 (GRCm39) K116* probably null Het
Kcnb1 T C 2: 167,030,161 (GRCm39) Y128C probably damaging Het
Kif5b G A 18: 6,225,672 (GRCm39) R171C probably damaging Het
Lcn4 G A 2: 26,561,228 (GRCm39) Q18* probably null Het
Lrp1b G A 2: 40,779,354 (GRCm39) Q2677* probably null Het
Map4k3 T A 17: 80,958,538 (GRCm39) T145S probably damaging Het
Mas1 T C 17: 13,060,898 (GRCm39) E175G probably benign Het
Metap2 T C 10: 93,707,366 (GRCm39) T202A probably benign Het
Mras A T 9: 99,275,054 (GRCm39) M131K probably benign Het
Mtor T C 4: 148,568,169 (GRCm39) V1092A probably damaging Het
Mug2 T C 6: 122,028,751 (GRCm39) S582P probably benign Het
Myo5b A G 18: 74,848,017 (GRCm39) N1085S probably damaging Het
Nav3 T C 10: 109,603,103 (GRCm39) T1149A probably benign Het
Nipbl A T 15: 8,366,373 (GRCm39) S1239T probably benign Het
Nkpd1 C A 7: 19,257,867 (GRCm39) R549S probably benign Het
Or10a3m T A 7: 108,312,677 (GRCm39) M39K probably benign Het
Or10p1 G A 10: 129,444,084 (GRCm39) H89Y probably benign Het
Or1j1 A G 2: 36,702,621 (GRCm39) L161P probably damaging Het
Or51i2 T A 7: 103,689,522 (GRCm39) V173D probably damaging Het
Pcdh18 T C 3: 49,711,229 (GRCm39) N29D probably benign Het
Pdzrn4 T C 15: 92,294,949 (GRCm39) W52R probably benign Het
Plekhb1 T C 7: 100,304,588 (GRCm39) K39E probably damaging Het
Pramel28 A G 4: 143,692,348 (GRCm39) S218P probably benign Het
Psmb4 C A 3: 94,792,285 (GRCm39) E212D probably benign Het
Rcc1l A G 5: 134,205,348 (GRCm39) L69P probably damaging Het
Robo2 T C 16: 73,729,952 (GRCm39) R1082G probably benign Het
Rorb T C 19: 18,955,115 (GRCm39) Y167C probably damaging Het
Sanbr T A 11: 23,534,590 (GRCm39) K589I probably damaging Het
Sbsn GGAAATATGGCAGACAAGTTTGGTCAGGGGGCCCACCATGCTTTTGGTCAGGGCAG GG 7: 30,452,067 (GRCm39) probably benign Het
Scaf8 T A 17: 3,248,170 (GRCm39) F1164L probably benign Het
Scn10a A T 9: 119,438,046 (GRCm39) M1940K probably benign Het
Serpinb2 A G 1: 107,452,298 (GRCm39) N292S probably benign Het
Sparcl1 C A 5: 104,234,998 (GRCm39) V506L possibly damaging Het
Stt3a A G 9: 36,661,025 (GRCm39) V262A possibly damaging Het
Syt17 C A 7: 118,036,191 (GRCm39) M58I probably benign Het
Tas2r134 A C 2: 51,518,358 (GRCm39) N279T possibly damaging Het
Tbc1d2 T C 4: 46,609,065 (GRCm39) E724G probably damaging Het
Teddm1b T A 1: 153,750,620 (GRCm39) L143Q Het
Tlk1 T A 2: 70,617,281 (GRCm39) R66S probably damaging Het
Tmem139 A T 6: 42,240,176 (GRCm39) probably null Het
Tom1l2 T C 11: 60,151,942 (GRCm39) Y155C possibly damaging Het
Trmt1l C A 1: 151,304,710 (GRCm39) S28* probably null Het
Ttf2 T C 3: 100,859,918 (GRCm39) I679V probably benign Het
Unc13b T G 4: 43,172,513 (GRCm39) F1114V Het
Vmn2r25 T A 6: 123,816,579 (GRCm39) D334V probably damaging Het
Vps13c T G 9: 67,856,715 (GRCm39) Y2581D probably damaging Het
Xkr5 A G 8: 18,984,247 (GRCm39) S432P probably benign Het
Zc2hc1b G A 10: 13,043,677 (GRCm39) P73S possibly damaging Het
Zfhx2 A C 14: 55,303,483 (GRCm39) F1500L probably benign Het
Zfp3 T G 11: 70,662,739 (GRCm39) S233A possibly damaging Het
Zmat5 T C 11: 4,687,453 (GRCm39) W169R probably damaging Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25,105,076 (GRCm39) critical splice donor site probably benign
primurus APN 19 25,160,973 (GRCm39) missense probably damaging 1.00
IGL00737:Dock8 APN 19 25,160,340 (GRCm39) missense probably benign 0.00
IGL00755:Dock8 APN 19 25,028,873 (GRCm39) missense probably benign 0.09
IGL00822:Dock8 APN 19 25,165,773 (GRCm39) nonsense probably null
IGL00838:Dock8 APN 19 25,152,823 (GRCm39) nonsense probably null
IGL01419:Dock8 APN 19 25,096,816 (GRCm39) missense probably benign 0.08
IGL01456:Dock8 APN 19 25,096,863 (GRCm39) missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25,146,805 (GRCm39) missense probably damaging 0.99
IGL01602:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01605:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01753:Dock8 APN 19 25,038,656 (GRCm39) splice site probably benign
IGL01843:Dock8 APN 19 25,067,292 (GRCm39) missense probably benign 0.02
IGL02032:Dock8 APN 19 25,107,769 (GRCm39) missense probably damaging 0.99
IGL02073:Dock8 APN 19 25,178,350 (GRCm39) critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25,055,569 (GRCm39) critical splice donor site probably null
IGL02402:Dock8 APN 19 25,055,509 (GRCm39) missense probably benign 0.25
IGL02529:Dock8 APN 19 25,078,290 (GRCm39) nonsense probably null
IGL02728:Dock8 APN 19 25,109,584 (GRCm39) missense probably benign
IGL02739:Dock8 APN 19 25,165,852 (GRCm39) missense probably damaging 1.00
IGL03037:Dock8 APN 19 25,063,545 (GRCm39) missense probably benign 0.02
IGL03104:Dock8 APN 19 25,178,384 (GRCm39) nonsense probably null
IGL03137:Dock8 APN 19 25,133,312 (GRCm39) missense probably benign 0.19
IGL03365:Dock8 APN 19 25,077,048 (GRCm39) missense possibly damaging 0.70
Defenseless UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
Guardate UTSW 19 25,127,195 (GRCm39) missense probably benign
hillock UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
Molehill UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
Pap UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
Papilla UTSW 19 25,055,448 (GRCm39) nonsense probably null
snowdrop UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
warts_and_all UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R0021:Dock8 UTSW 19 25,140,411 (GRCm39) missense probably benign 0.01
R0147:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0148:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0294:Dock8 UTSW 19 25,165,714 (GRCm39) missense probably damaging 1.00
R0537:Dock8 UTSW 19 25,148,941 (GRCm39) missense probably benign 0.08
R0630:Dock8 UTSW 19 25,038,524 (GRCm39) missense probably benign 0.10
R1163:Dock8 UTSW 19 25,028,867 (GRCm39) missense probably benign
R1164:Dock8 UTSW 19 25,067,391 (GRCm39) missense probably benign 0.44
R1471:Dock8 UTSW 19 25,178,400 (GRCm39) missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
R1803:Dock8 UTSW 19 25,109,599 (GRCm39) missense probably benign 0.00
R1822:Dock8 UTSW 19 25,138,422 (GRCm39) missense probably benign 0.31
R1852:Dock8 UTSW 19 25,104,492 (GRCm39) missense probably benign 0.45
R1916:Dock8 UTSW 19 25,038,521 (GRCm39) missense probably benign 0.02
R1984:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R2311:Dock8 UTSW 19 25,160,368 (GRCm39) missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25,177,757 (GRCm39) missense probably damaging 0.99
R2483:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3116:Dock8 UTSW 19 25,165,858 (GRCm39) missense probably benign 0.00
R3157:Dock8 UTSW 19 25,127,195 (GRCm39) missense probably benign
R3623:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3624:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3800:Dock8 UTSW 19 25,141,716 (GRCm39) missense probably benign 0.08
R3844:Dock8 UTSW 19 25,042,794 (GRCm39) nonsense probably null
R3895:Dock8 UTSW 19 25,028,865 (GRCm39) missense probably benign 0.31
R3901:Dock8 UTSW 19 25,078,269 (GRCm39) missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
R4428:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4428:Dock8 UTSW 19 25,177,863 (GRCm39) missense probably damaging 0.98
R4429:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4431:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4545:Dock8 UTSW 19 25,165,722 (GRCm39) missense probably damaging 1.00
R4839:Dock8 UTSW 19 25,146,858 (GRCm39) missense probably benign 0.00
R4897:Dock8 UTSW 19 25,159,001 (GRCm39) missense probably benign 0.00
R4939:Dock8 UTSW 19 25,099,764 (GRCm39) missense probably damaging 1.00
R4995:Dock8 UTSW 19 25,135,747 (GRCm39) missense probably benign 0.02
R5035:Dock8 UTSW 19 25,063,571 (GRCm39) missense probably damaging 0.99
R5294:Dock8 UTSW 19 25,038,517 (GRCm39) missense probably benign 0.01
R5324:Dock8 UTSW 19 25,140,458 (GRCm39) missense probably benign 0.17
R5478:Dock8 UTSW 19 25,057,186 (GRCm39) missense probably benign
R5704:Dock8 UTSW 19 25,151,586 (GRCm39) missense probably damaging 1.00
R5724:Dock8 UTSW 19 25,099,785 (GRCm39) missense probably damaging 1.00
R5745:Dock8 UTSW 19 25,107,761 (GRCm39) missense probably benign 0.02
R5864:Dock8 UTSW 19 25,038,584 (GRCm39) missense probably damaging 0.99
R5870:Dock8 UTSW 19 25,109,490 (GRCm39) missense probably benign
R5893:Dock8 UTSW 19 25,099,811 (GRCm39) missense probably damaging 1.00
R5954:Dock8 UTSW 19 25,148,983 (GRCm39) missense probably damaging 1.00
R6087:Dock8 UTSW 19 25,138,438 (GRCm39) missense probably benign 0.00
R6223:Dock8 UTSW 19 25,138,416 (GRCm39) missense probably benign 0.00
R6391:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25,104,848 (GRCm39) missense probably damaging 0.99
R6786:Dock8 UTSW 19 25,160,386 (GRCm39) missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
R6818:Dock8 UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R6885:Dock8 UTSW 19 25,124,742 (GRCm39) missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25,165,746 (GRCm39) missense probably damaging 1.00
R6923:Dock8 UTSW 19 25,072,970 (GRCm39) missense probably benign
R7001:Dock8 UTSW 19 25,077,041 (GRCm39) missense probably benign
R7141:Dock8 UTSW 19 25,158,984 (GRCm39) missense probably null 0.75
R7203:Dock8 UTSW 19 25,158,927 (GRCm39) missense probably damaging 1.00
R7257:Dock8 UTSW 19 25,104,449 (GRCm39) missense probably benign 0.08
R7296:Dock8 UTSW 19 25,162,245 (GRCm39) missense probably benign 0.00
R7538:Dock8 UTSW 19 25,135,782 (GRCm39) missense probably damaging 1.00
R7555:Dock8 UTSW 19 25,152,764 (GRCm39) missense probably damaging 0.99
R7641:Dock8 UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
R7764:Dock8 UTSW 19 25,074,899 (GRCm39) missense probably benign
R7859:Dock8 UTSW 19 25,160,934 (GRCm39) missense probably damaging 1.00
R7864:Dock8 UTSW 19 25,140,864 (GRCm39) missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25,131,606 (GRCm39) missense probably damaging 1.00
R8160:Dock8 UTSW 19 25,124,711 (GRCm39) missense probably damaging 1.00
R8287:Dock8 UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
R8295:Dock8 UTSW 19 25,100,600 (GRCm39) missense probably benign 0.04
R8443:Dock8 UTSW 19 25,133,281 (GRCm39) missense probably benign 0.04
R8537:Dock8 UTSW 19 25,107,870 (GRCm39) missense probably benign 0.00
R8673:Dock8 UTSW 19 25,160,867 (GRCm39) missense probably damaging 0.96
R8709:Dock8 UTSW 19 25,055,448 (GRCm39) nonsense probably null
R8834:Dock8 UTSW 19 25,140,834 (GRCm39) missense probably benign 0.16
R8991:Dock8 UTSW 19 25,165,731 (GRCm39) missense possibly damaging 0.82
R9292:Dock8 UTSW 19 25,160,995 (GRCm39) splice site probably benign
R9509:Dock8 UTSW 19 25,072,985 (GRCm39) missense probably benign 0.00
R9526:Dock8 UTSW 19 25,165,739 (GRCm39) missense probably benign 0.10
R9634:Dock8 UTSW 19 25,169,585 (GRCm39) missense probably damaging 1.00
R9654:Dock8 UTSW 19 25,124,710 (GRCm39) missense probably damaging 1.00
R9670:Dock8 UTSW 19 25,148,926 (GRCm39) missense probably null 0.01
R9699:Dock8 UTSW 19 25,133,388 (GRCm39) critical splice donor site probably null
R9726:Dock8 UTSW 19 25,154,374 (GRCm39) missense probably damaging 0.97
R9765:Dock8 UTSW 19 25,146,832 (GRCm39) missense possibly damaging 0.94
X0027:Dock8 UTSW 19 25,138,493 (GRCm39) missense probably benign
Z1177:Dock8 UTSW 19 25,133,336 (GRCm39) missense probably benign 0.16
Z1177:Dock8 UTSW 19 25,109,487 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACTTATAAACTACAGCTCTGGGAG -3'
(R):5'- CTCTGGATTTCAGACCAAGTGAG -3'

Sequencing Primer
(F):5'- TCTGGGAGAGCAGTGTCC -3'
(R):5'- CAGAGGTCCTGAGTTCAATTCCTAG -3'
Posted On 2022-09-12