Incidental Mutation 'R9622:Dock8'
ID 724915
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Name dedicator of cytokinesis 8
Synonyms A130095G14Rik, 5830472H07Rik, 1200017A24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R9622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 24999529-25202432 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25121181 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 623 (N623S)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
AlphaFold Q8C147
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000025831
AA Change: N623S
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: N623S

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T A 11: 23,584,590 K589I probably damaging Het
2610301B20Rik T C 4: 10,893,304 I141T possibly damaging Het
Ablim2 A G 5: 35,849,545 K435E probably damaging Het
Acly T C 11: 100,504,959 T412A probably damaging Het
Aldh3b2 T A 19: 3,979,489 D287E probably benign Het
Asphd1 G A 7: 126,948,802 P110S Het
Atg7 T C 6: 114,678,032 L142P probably benign Het
Atp13a4 T C 16: 29,420,459 I796V Het
Bbx A G 16: 50,274,659 V98A probably damaging Het
Brca2 T C 5: 150,556,945 S2727P probably damaging Het
Camk1 T A 6: 113,341,889 D21V possibly damaging Het
Cdc5l A T 17: 45,404,783 D634E probably benign Het
Cyfip1 A T 7: 55,879,105 D275V possibly damaging Het
Cyp4a30b A G 4: 115,470,965 E477G probably damaging Het
Cyp4f16 C T 17: 32,550,272 P379S probably damaging Het
Dchs2 C T 3: 83,356,459 Q3345* probably null Het
Dnaaf1 A G 8: 119,588,262 T270A possibly damaging Het
Dnah3 A G 7: 119,962,133 V334A Het
Dnhd1 T C 7: 105,704,135 F2832L probably benign Het
Eif4enif1 T C 11: 3,215,714 I97T probably benign Het
Elmo1 C G 13: 20,208,140 P29A probably benign Het
Erich6 G C 3: 58,636,741 P142A possibly damaging Het
Fam135b T C 15: 71,525,837 R125G probably damaging Het
Fcrla T A 1: 170,922,239 H83L probably damaging Het
Flt3 C T 5: 147,367,031 E366K possibly damaging Het
Gabbr2 C T 4: 46,724,283 probably null Het
Gigyf1 T A 5: 137,524,664 L809* probably null Het
Glg1 C T 8: 111,172,501 G711R probably damaging Het
Gm13101 A G 4: 143,965,778 S218P probably benign Het
Gp1bb T C 16: 18,620,777 E189G probably benign Het
H2-Q1 A T 17: 35,323,556 I326F probably benign Het
Hoxb3 A T 11: 96,344,594 K116* probably null Het
Kcnb1 T C 2: 167,188,241 Y128C probably damaging Het
Kif5b G A 18: 6,225,672 R171C probably damaging Het
Lcn4 G A 2: 26,671,216 Q18* probably null Het
Lrp1b G A 2: 40,889,342 Q2677* probably null Het
Map4k3 T A 17: 80,651,109 T145S probably damaging Het
Mas1 T C 17: 12,842,011 E175G probably benign Het
Metap2 T C 10: 93,871,504 T202A probably benign Het
Mras A T 9: 99,393,001 M131K probably benign Het
Mtor T C 4: 148,483,712 V1092A probably damaging Het
Mug2 T C 6: 122,051,792 S582P probably benign Het
Myo5b A G 18: 74,714,946 N1085S probably damaging Het
Nav3 T C 10: 109,767,242 T1149A probably benign Het
Nipbl A T 15: 8,336,889 S1239T probably benign Het
Nkpd1 C A 7: 19,523,942 R549S probably benign Het
Olfr3 A G 2: 36,812,609 L161P probably damaging Het
Olfr512 T A 7: 108,713,470 M39K probably benign Het
Olfr641 T A 7: 104,040,315 V173D probably damaging Het
Olfr796 G A 10: 129,608,215 H89Y probably benign Het
Pcdh18 T C 3: 49,756,780 N29D probably benign Het
Pdzrn4 T C 15: 92,397,068 W52R probably benign Het
Plekhb1 T C 7: 100,655,381 K39E probably damaging Het
Psmb4 C A 3: 94,884,974 E212D probably benign Het
Rcc1l A G 5: 134,176,509 L69P probably damaging Het
Robo2 T C 16: 73,933,064 R1082G probably benign Het
Rorb T C 19: 18,977,751 Y167C probably damaging Het
Sbsn GGAAATATGGCAGACAAGTTTGGTCAGGGGGCCCACCATGCTTTTGGTCAGGGCAG GG 7: 30,752,642 probably benign Het
Scaf8 T A 17: 3,197,895 F1164L probably benign Het
Scn10a A T 9: 119,608,980 M1940K probably benign Het
Serpinb2 A G 1: 107,524,568 N292S probably benign Het
Sparcl1 C A 5: 104,087,132 V506L possibly damaging Het
Stt3a A G 9: 36,749,729 V262A possibly damaging Het
Syt17 C A 7: 118,436,968 M58I probably benign Het
Tas2r134 A C 2: 51,628,346 N279T possibly damaging Het
Tbc1d2 T C 4: 46,609,065 E724G probably damaging Het
Teddm1b T A 1: 153,874,874 L143Q Het
Tlk1 T A 2: 70,786,937 R66S probably damaging Het
Tmem139 A T 6: 42,263,242 probably null Het
Tom1l2 T C 11: 60,261,116 Y155C possibly damaging Het
Trmt1l C A 1: 151,428,959 S28* probably null Het
Ttf2 T C 3: 100,952,602 I679V probably benign Het
Unc13b T G 4: 43,172,513 F1114V Het
Vmn2r25 T A 6: 123,839,620 D334V probably damaging Het
Vps13c T G 9: 67,949,433 Y2581D probably damaging Het
Xkr5 A G 8: 18,934,231 S432P probably benign Het
Zc2hc1b G A 10: 13,167,933 P73S possibly damaging Het
Zfhx2 A C 14: 55,066,026 F1500L probably benign Het
Zfp3 T G 11: 70,771,913 S233A possibly damaging Het
Zmat5 T C 11: 4,737,453 W169R probably damaging Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25127711 critical splice donor site probably benign
primurus APN 19 25183609 missense probably damaging 1.00
IGL00737:Dock8 APN 19 25182976 missense probably benign 0.00
IGL00755:Dock8 APN 19 25051509 missense probably benign 0.09
IGL00822:Dock8 APN 19 25188409 nonsense probably null
IGL00838:Dock8 APN 19 25175459 nonsense probably null
IGL01419:Dock8 APN 19 25119452 missense probably benign 0.08
IGL01456:Dock8 APN 19 25119499 missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25169441 missense probably damaging 0.99
IGL01602:Dock8 APN 19 25089888 splice site probably benign
IGL01605:Dock8 APN 19 25089888 splice site probably benign
IGL01753:Dock8 APN 19 25061292 splice site probably benign
IGL01843:Dock8 APN 19 25089928 missense probably benign 0.02
IGL02032:Dock8 APN 19 25130405 missense probably damaging 0.99
IGL02073:Dock8 APN 19 25200986 critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25078205 critical splice donor site probably null
IGL02402:Dock8 APN 19 25078145 missense probably benign 0.25
IGL02529:Dock8 APN 19 25100926 nonsense probably null
IGL02728:Dock8 APN 19 25132220 missense probably benign
IGL02739:Dock8 APN 19 25188488 missense probably damaging 1.00
IGL03037:Dock8 APN 19 25086181 missense probably benign 0.02
IGL03104:Dock8 APN 19 25201020 nonsense probably null
IGL03137:Dock8 APN 19 25155948 missense probably benign 0.19
IGL03365:Dock8 APN 19 25099684 missense possibly damaging 0.70
Defenseless UTSW 19 25051563 missense probably benign 0.00
Guardate UTSW 19 25149831 missense probably benign
hillock UTSW 19 25174333 critical splice donor site probably null
Molehill UTSW 19 25130461 missense probably damaging 1.00
Pap UTSW 19 25122441 missense probably benign 0.31
Papilla UTSW 19 25078084 nonsense probably null
snowdrop UTSW 19 25184941 critical splice donor site probably null
warts_and_all UTSW 19 25169501 critical splice donor site probably null
R0021:Dock8 UTSW 19 25163047 missense probably benign 0.01
R0147:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0148:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0294:Dock8 UTSW 19 25188350 missense probably damaging 1.00
R0537:Dock8 UTSW 19 25171577 missense probably benign 0.08
R0630:Dock8 UTSW 19 25061160 missense probably benign 0.10
R1163:Dock8 UTSW 19 25051503 missense probably benign
R1164:Dock8 UTSW 19 25090027 missense probably benign 0.44
R1471:Dock8 UTSW 19 25201036 missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25051563 missense probably benign 0.00
R1803:Dock8 UTSW 19 25132235 missense probably benign 0.00
R1822:Dock8 UTSW 19 25161058 missense probably benign 0.31
R1852:Dock8 UTSW 19 25127128 missense probably benign 0.45
R1916:Dock8 UTSW 19 25061157 missense probably benign 0.02
R1984:Dock8 UTSW 19 25121181 missense probably null
R2311:Dock8 UTSW 19 25183004 missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25200393 missense probably damaging 0.99
R2483:Dock8 UTSW 19 25079877 missense probably benign
R3116:Dock8 UTSW 19 25188494 missense probably benign 0.00
R3157:Dock8 UTSW 19 25149831 missense probably benign
R3623:Dock8 UTSW 19 25079877 missense probably benign
R3624:Dock8 UTSW 19 25079877 missense probably benign
R3800:Dock8 UTSW 19 25164352 missense probably benign 0.08
R3844:Dock8 UTSW 19 25065430 nonsense probably null
R3895:Dock8 UTSW 19 25051501 missense probably benign 0.31
R3901:Dock8 UTSW 19 25100905 missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25184941 critical splice donor site probably null
R4428:Dock8 UTSW 19 25200499 missense probably damaging 0.98
R4428:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4429:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4431:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4545:Dock8 UTSW 19 25188358 missense probably damaging 1.00
R4839:Dock8 UTSW 19 25169494 missense probably benign 0.00
R4897:Dock8 UTSW 19 25181637 missense probably benign 0.00
R4939:Dock8 UTSW 19 25122400 missense probably damaging 1.00
R4995:Dock8 UTSW 19 25158383 missense probably benign 0.02
R5035:Dock8 UTSW 19 25086207 missense probably damaging 0.99
R5294:Dock8 UTSW 19 25061153 missense probably benign 0.01
R5324:Dock8 UTSW 19 25163094 missense probably benign 0.17
R5478:Dock8 UTSW 19 25079822 missense probably benign
R5704:Dock8 UTSW 19 25174222 missense probably damaging 1.00
R5724:Dock8 UTSW 19 25122421 missense probably damaging 1.00
R5745:Dock8 UTSW 19 25130397 missense probably benign 0.02
R5864:Dock8 UTSW 19 25061220 missense probably damaging 0.99
R5870:Dock8 UTSW 19 25132126 missense probably benign
R5893:Dock8 UTSW 19 25122447 missense probably damaging 1.00
R5954:Dock8 UTSW 19 25171619 missense probably damaging 1.00
R6087:Dock8 UTSW 19 25161074 missense probably benign 0.00
R6223:Dock8 UTSW 19 25161052 missense probably benign 0.00
R6391:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25127484 missense probably damaging 0.99
R6786:Dock8 UTSW 19 25183022 missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25122441 missense probably benign 0.31
R6818:Dock8 UTSW 19 25169501 critical splice donor site probably null
R6885:Dock8 UTSW 19 25147378 missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25188382 missense probably damaging 1.00
R6923:Dock8 UTSW 19 25095606 missense probably benign
R7001:Dock8 UTSW 19 25099677 missense probably benign
R7141:Dock8 UTSW 19 25181620 missense probably null 0.75
R7203:Dock8 UTSW 19 25181563 missense probably damaging 1.00
R7257:Dock8 UTSW 19 25127085 missense probably benign 0.08
R7296:Dock8 UTSW 19 25184881 missense probably benign 0.00
R7538:Dock8 UTSW 19 25158418 missense probably damaging 1.00
R7555:Dock8 UTSW 19 25175400 missense probably damaging 0.99
R7641:Dock8 UTSW 19 25174333 critical splice donor site probably null
R7764:Dock8 UTSW 19 25097535 missense probably benign
R7859:Dock8 UTSW 19 25183570 missense probably damaging 1.00
R7864:Dock8 UTSW 19 25163500 missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25154242 missense probably damaging 1.00
R8160:Dock8 UTSW 19 25147347 missense probably damaging 1.00
R8287:Dock8 UTSW 19 25130461 missense probably damaging 1.00
R8295:Dock8 UTSW 19 25123236 missense probably benign 0.04
R8443:Dock8 UTSW 19 25155917 missense probably benign 0.04
R8537:Dock8 UTSW 19 25130506 missense probably benign 0.00
R8673:Dock8 UTSW 19 25183503 missense probably damaging 0.96
R8709:Dock8 UTSW 19 25078084 nonsense probably null
R8834:Dock8 UTSW 19 25163470 missense probably benign 0.16
R8991:Dock8 UTSW 19 25188367 missense possibly damaging 0.82
R9292:Dock8 UTSW 19 25183631 splice site probably benign
R9509:Dock8 UTSW 19 25095621 missense probably benign 0.00
R9526:Dock8 UTSW 19 25188375 missense probably benign 0.10
R9634:Dock8 UTSW 19 25192221 missense probably damaging 1.00
R9654:Dock8 UTSW 19 25147346 missense probably damaging 1.00
R9670:Dock8 UTSW 19 25171562 missense probably null 0.01
R9699:Dock8 UTSW 19 25156024 critical splice donor site probably null
R9726:Dock8 UTSW 19 25177010 missense probably damaging 0.97
R9765:Dock8 UTSW 19 25169468 missense possibly damaging 0.94
X0027:Dock8 UTSW 19 25161129 missense probably benign
Z1177:Dock8 UTSW 19 25132123 missense probably benign 0.05
Z1177:Dock8 UTSW 19 25155972 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACTTATAAACTACAGCTCTGGGAG -3'
(R):5'- CTCTGGATTTCAGACCAAGTGAG -3'

Sequencing Primer
(F):5'- TCTGGGAGAGCAGTGTCC -3'
(R):5'- CAGAGGTCCTGAGTTCAATTCCTAG -3'
Posted On 2022-09-12