Incidental Mutation 'R9623:Zfp352'
ID 724936
Institutional Source Beutler Lab
Gene Symbol Zfp352
Ensembl Gene ENSMUSG00000070902
Gene Name zinc finger protein 352
Synonyms 2czf48
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9623 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 90107057-90113924 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90113128 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 423 (K423E)
Ref Sequence ENSEMBL: ENSMUSP00000102746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080541] [ENSMUST00000107129]
AlphaFold A2AML7
Predicted Effect probably benign
Transcript: ENSMUST00000080541
AA Change: K423E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079383
Gene: ENSMUSG00000070902
AA Change: K423E

DomainStartEndE-ValueType
ZnF_C2H2 459 483 3.34e-2 SMART
ZnF_C2H2 489 513 8.22e-2 SMART
ZnF_C2H2 519 542 1.76e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107129
AA Change: K423E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102746
Gene: ENSMUSG00000070902
AA Change: K423E

DomainStartEndE-ValueType
ZnF_C2H2 459 483 3.34e-2 SMART
ZnF_C2H2 489 513 8.22e-2 SMART
ZnF_C2H2 519 542 1.76e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 A T 7: 119,181,975 (GRCm39) Y408F probably benign Het
Adamts9 G T 6: 92,857,661 (GRCm39) P876T probably benign Het
Afap1l2 T A 19: 56,906,462 (GRCm39) D479V probably damaging Het
Aire T C 10: 77,873,809 (GRCm39) E300G probably damaging Het
Ampd3 A G 7: 110,402,307 (GRCm39) E428G probably damaging Het
Apaf1 A T 10: 90,913,463 (GRCm39) Y153* probably null Het
Arhgap10 T C 8: 77,985,786 (GRCm39) T694A probably benign Het
Arhgef39 A G 4: 43,496,819 (GRCm39) probably null Het
Arhgef5 T C 6: 43,251,736 (GRCm39) V829A possibly damaging Het
Arrdc4 A G 7: 68,390,741 (GRCm39) M333T Het
Boc G T 16: 44,322,018 (GRCm39) R215S Het
Capn2 G A 1: 182,344,795 (GRCm39) A42V probably benign Het
Ccdc136 T A 6: 29,405,939 (GRCm39) M95K probably benign Het
Ccdc183 A T 2: 25,499,520 (GRCm39) Y438N probably benign Het
Ccnf C A 17: 24,468,367 (GRCm39) R10M probably damaging Het
Cd19 A G 7: 126,011,284 (GRCm39) F300S probably damaging Het
Cdkl3 G T 11: 51,895,816 (GRCm39) C21F probably damaging Het
Celf2 C T 2: 6,620,522 (GRCm39) R183Q probably damaging Het
Clca3a1 T G 3: 144,719,698 (GRCm39) D424A probably benign Het
Clec3a A G 8: 115,144,887 (GRCm39) D21G probably benign Het
Clec4e T C 6: 123,263,306 (GRCm39) N78S probably benign Het
Clpb A T 7: 101,313,399 (GRCm39) S128C possibly damaging Het
Cntnap5a T A 1: 116,369,985 (GRCm39) Y867* probably null Het
Dgkg G C 16: 22,385,194 (GRCm39) N437K Het
Dnhd1 A G 7: 105,335,773 (GRCm39) E1139G probably damaging Het
Dnhd1 G A 7: 105,344,134 (GRCm39) R1826H probably damaging Het
Etl4 A G 2: 20,811,052 (GRCm39) H1413R Het
Fibp T A 19: 5,513,850 (GRCm39) V271D possibly damaging Het
Gabra4 G T 5: 71,791,023 (GRCm39) T273K probably damaging Het
Gan G A 8: 117,914,219 (GRCm39) D206N probably damaging Het
Gstz1 A T 12: 87,206,923 (GRCm39) I106F probably damaging Het
Hivep2 T G 10: 14,006,546 (GRCm39) L1048R probably damaging Het
Htr6 A T 4: 138,801,750 (GRCm39) M108K probably damaging Het
Hycc1 A C 5: 24,170,255 (GRCm39) S365A probably benign Het
Itgad A G 7: 127,803,723 (GRCm39) E1134G probably damaging Het
Lrp1b C T 2: 41,366,648 (GRCm39) G657S Het
Lrp2 T C 2: 69,307,423 (GRCm39) I2879V probably benign Het
Lyst G T 13: 13,852,587 (GRCm39) V2196L probably benign Het
Mettl5 T A 2: 69,711,717 (GRCm39) I50F possibly damaging Het
Mmadhc A G 2: 50,186,341 (GRCm39) probably benign Het
Msantd1 G A 5: 35,075,076 (GRCm39) W46* probably null Het
Mto1 T C 9: 78,364,712 (GRCm39) I317T probably damaging Het
Myef2 T G 2: 124,957,377 (GRCm39) D126A probably damaging Het
Net1 A G 13: 3,937,569 (GRCm39) probably null Het
Nnmt A T 9: 48,503,660 (GRCm39) M122K probably benign Het
Nos1 A G 5: 118,087,849 (GRCm39) K1371E probably benign Het
Nrcam G C 12: 44,636,931 (GRCm39) W1121C probably damaging Het
Nt5c2 A G 19: 46,877,409 (GRCm39) S511P Het
Or10w1 C A 19: 13,632,414 (GRCm39) A207E probably damaging Het
Or1j17 G T 2: 36,578,778 (GRCm39) V255F probably benign Het
Or2k2 T C 4: 58,785,585 (GRCm39) I46V possibly damaging Het
Or4a73 A G 2: 89,421,261 (GRCm39) F66S probably benign Het
P2rx7 A G 5: 122,790,860 (GRCm39) K66E probably damaging Het
Paqr4 A G 17: 23,956,656 (GRCm39) W236R probably damaging Het
Parm1 A G 5: 91,760,923 (GRCm39) Y265C probably damaging Het
Pcbp2 T C 15: 102,392,628 (GRCm39) Y178H probably damaging Het
Pidd1 G A 7: 141,021,678 (GRCm39) P261S probably damaging Het
Pik3r6 T C 11: 68,442,159 (GRCm39) V705A possibly damaging Het
Pla2g15 G T 8: 106,887,275 (GRCm39) V156F possibly damaging Het
Prpf6 G A 2: 181,289,137 (GRCm39) V609M possibly damaging Het
Resf1 A G 6: 149,226,965 (GRCm39) N4D possibly damaging Het
Rprd2 A G 3: 95,679,505 (GRCm39) V491A probably benign Het
Rtp3 T A 9: 110,818,600 (GRCm39) H27L probably damaging Het
Sema5b G A 16: 35,443,121 (GRCm39) R42Q possibly damaging Het
Serpina3f A G 12: 104,183,743 (GRCm39) K202E probably damaging Het
Slc25a33 T G 4: 149,833,767 (GRCm39) M168L probably benign Het
Slc7a8 A G 14: 54,964,341 (GRCm39) C371R probably damaging Het
Smyd1 T C 6: 71,192,808 (GRCm39) N467S probably benign Het
Sptbn4 A G 7: 27,107,807 (GRCm39) W872R probably damaging Het
Syne1 A T 10: 5,152,009 (GRCm39) I5766N probably damaging Het
Syne2 A G 12: 75,986,760 (GRCm39) S1699G probably benign Het
Synpo2 T C 3: 122,908,047 (GRCm39) D423G possibly damaging Het
Tcf19 A T 17: 35,825,792 (GRCm39) F122I probably damaging Het
Tdpoz4 A T 3: 93,704,221 (GRCm39) T173S probably benign Het
Trappc8 T A 18: 20,983,975 (GRCm39) H681L possibly damaging Het
Trim36 A G 18: 46,308,623 (GRCm39) F413S probably benign Het
Tsks A G 7: 44,605,931 (GRCm39) T466A possibly damaging Het
Ubr1 T C 2: 120,764,820 (GRCm39) I545V probably benign Het
Ubr4 A G 4: 139,159,024 (GRCm39) E1170G probably benign Het
Usp29 A G 7: 6,964,396 (GRCm39) R80G possibly damaging Het
Utrn C T 10: 12,282,225 (GRCm39) R3258H probably damaging Het
Vmn1r13 T G 6: 57,187,549 (GRCm39) V236G probably benign Het
Vmn1r33 T A 6: 66,589,002 (GRCm39) D184V probably damaging Het
Vmn2r87 T C 10: 130,315,794 (GRCm39) N91D probably damaging Het
Wrn A G 8: 33,774,644 (GRCm39) probably null Het
Zan G A 5: 137,461,636 (GRCm39) P1181L unknown Het
Zbtb47 C A 9: 121,591,990 (GRCm39) Y103* probably null Het
Zfc3h1 C A 10: 115,259,362 (GRCm39) L1645I possibly damaging Het
Zfhx2 G T 14: 55,302,191 (GRCm39) P1931Q probably damaging Het
Zfp574 T A 7: 24,780,515 (GRCm39) H512Q Het
Zfp7 G A 15: 76,774,531 (GRCm39) R191H probably benign Het
Zfp771 A T 7: 126,844,301 (GRCm39) K46* probably null Het
Zkscan8 T C 13: 21,704,763 (GRCm39) E392G probably damaging Het
Other mutations in Zfp352
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Zfp352 APN 4 90,112,391 (GRCm39) missense possibly damaging 0.95
IGL02252:Zfp352 APN 4 90,112,367 (GRCm39) missense probably benign 0.02
IGL03156:Zfp352 APN 4 90,112,324 (GRCm39) missense possibly damaging 0.57
IGL03167:Zfp352 APN 4 90,112,939 (GRCm39) missense probably damaging 0.99
IGL03190:Zfp352 APN 4 90,111,994 (GRCm39) missense possibly damaging 0.94
IGL03335:Zfp352 APN 4 90,112,583 (GRCm39) missense probably damaging 0.99
R0051:Zfp352 UTSW 4 90,112,522 (GRCm39) missense probably damaging 0.99
R0403:Zfp352 UTSW 4 90,113,246 (GRCm39) missense possibly damaging 0.60
R0550:Zfp352 UTSW 4 90,112,927 (GRCm39) missense probably damaging 0.99
R0671:Zfp352 UTSW 4 90,112,156 (GRCm39) missense probably benign
R1034:Zfp352 UTSW 4 90,112,393 (GRCm39) missense possibly damaging 0.94
R1754:Zfp352 UTSW 4 90,112,046 (GRCm39) missense probably benign 0.23
R2016:Zfp352 UTSW 4 90,113,408 (GRCm39) missense probably benign 0.42
R2064:Zfp352 UTSW 4 90,113,357 (GRCm39) missense probably benign 0.08
R2308:Zfp352 UTSW 4 90,113,480 (GRCm39) missense probably benign 0.00
R3552:Zfp352 UTSW 4 90,113,339 (GRCm39) missense probably benign 0.33
R3794:Zfp352 UTSW 4 90,113,386 (GRCm39) missense probably damaging 1.00
R3795:Zfp352 UTSW 4 90,113,386 (GRCm39) missense probably damaging 1.00
R4135:Zfp352 UTSW 4 90,113,261 (GRCm39) missense probably damaging 0.96
R4356:Zfp352 UTSW 4 90,112,071 (GRCm39) missense possibly damaging 0.91
R4409:Zfp352 UTSW 4 90,113,401 (GRCm39) missense probably benign 0.00
R4590:Zfp352 UTSW 4 90,112,772 (GRCm39) missense probably damaging 0.98
R4614:Zfp352 UTSW 4 90,113,318 (GRCm39) missense probably benign 0.00
R4617:Zfp352 UTSW 4 90,113,318 (GRCm39) missense probably benign 0.00
R4618:Zfp352 UTSW 4 90,113,318 (GRCm39) missense probably benign 0.00
R4741:Zfp352 UTSW 4 90,113,177 (GRCm39) missense possibly damaging 0.94
R4931:Zfp352 UTSW 4 90,112,541 (GRCm39) missense probably damaging 0.98
R4959:Zfp352 UTSW 4 90,112,376 (GRCm39) missense probably benign 0.01
R4973:Zfp352 UTSW 4 90,112,376 (GRCm39) missense probably benign 0.01
R5167:Zfp352 UTSW 4 90,112,453 (GRCm39) missense possibly damaging 0.94
R5260:Zfp352 UTSW 4 90,112,697 (GRCm39) missense probably damaging 0.99
R5524:Zfp352 UTSW 4 90,113,341 (GRCm39) missense possibly damaging 0.95
R5942:Zfp352 UTSW 4 90,113,307 (GRCm39) missense probably damaging 0.98
R6802:Zfp352 UTSW 4 90,113,437 (GRCm39) missense probably benign 0.33
R6819:Zfp352 UTSW 4 90,112,936 (GRCm39) missense probably benign
R7072:Zfp352 UTSW 4 90,112,661 (GRCm39) missense probably benign 0.00
R7099:Zfp352 UTSW 4 90,113,117 (GRCm39) missense probably benign 0.00
R7569:Zfp352 UTSW 4 90,111,896 (GRCm39) missense possibly damaging 0.77
R7645:Zfp352 UTSW 4 90,113,014 (GRCm39) missense probably benign 0.13
R7705:Zfp352 UTSW 4 90,113,512 (GRCm39) missense possibly damaging 0.94
R8424:Zfp352 UTSW 4 90,112,480 (GRCm39) missense possibly damaging 0.87
R9180:Zfp352 UTSW 4 90,113,118 (GRCm39) missense probably benign 0.38
R9378:Zfp352 UTSW 4 90,112,575 (GRCm39) missense probably benign 0.13
R9509:Zfp352 UTSW 4 90,112,943 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGAGACAAGTCCCACATCTG -3'
(R):5'- AGGCTCATCACACCCGTATTTC -3'

Sequencing Primer
(F):5'- CTGAAGAAACACTCTACTTGGGTCAG -3'
(R):5'- ACACCCGTATTTCCTCTTATCAGTG -3'
Posted On 2022-09-12