Incidental Mutation 'R9623:Arhgef5'
ID 724948
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor (GEF) 5
Synonyms 2210412D05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9623 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 43265582-43289320 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43274802 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 829 (V829A)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect possibly damaging
Transcript: ENSMUST00000031750
AA Change: V829A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: V829A

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,325,467 N4D possibly damaging Het
Acsm2 A T 7: 119,582,752 Y408F probably benign Het
Adamts9 G T 6: 92,880,680 P876T probably benign Het
Afap1l2 T A 19: 56,918,030 D479V probably damaging Het
Aire T C 10: 78,037,975 E300G probably damaging Het
Ampd3 A G 7: 110,803,100 E428G probably damaging Het
Apaf1 A T 10: 91,077,601 Y153* probably null Het
Arhgap10 T C 8: 77,259,157 T694A probably benign Het
Arhgef39 A G 4: 43,496,819 probably null Het
Arrdc4 A G 7: 68,740,993 M333T Het
Boc G T 16: 44,501,655 R215S Het
Capn2 G A 1: 182,517,230 A42V probably benign Het
Ccdc136 T A 6: 29,405,940 M95K probably benign Het
Ccdc183 A T 2: 25,609,508 Y438N probably benign Het
Ccnf C A 17: 24,249,393 R10M probably damaging Het
Cd19 A G 7: 126,412,112 F300S probably damaging Het
Cdkl3 G T 11: 52,004,989 C21F probably damaging Het
Celf2 C T 2: 6,615,711 R183Q probably damaging Het
Clca1 T G 3: 145,013,937 D424A probably benign Het
Clec3a A G 8: 114,418,147 D21G probably benign Het
Clec4e T C 6: 123,286,347 N78S probably benign Het
Clpb A T 7: 101,664,192 S128C possibly damaging Het
Cntnap5a T A 1: 116,442,255 Y867* probably null Het
Dgkg G C 16: 22,566,444 N437K Het
Dnhd1 A G 7: 105,686,566 E1139G probably damaging Het
Dnhd1 G A 7: 105,694,927 R1826H probably damaging Het
Etl4 A G 2: 20,806,241 H1413R Het
Fam126a A C 5: 23,965,257 S365A probably benign Het
Fibp T A 19: 5,463,822 V271D possibly damaging Het
Gabra4 G T 5: 71,633,680 T273K probably damaging Het
Gan G A 8: 117,187,480 D206N probably damaging Het
Gstz1 A T 12: 87,160,149 I106F probably damaging Het
Hivep2 T G 10: 14,130,802 L1048R probably damaging Het
Htr6 A T 4: 139,074,439 M108K probably damaging Het
Itgad A G 7: 128,204,551 E1134G probably damaging Het
Lrp1b C T 2: 41,476,636 G657S Het
Lrp2 T C 2: 69,477,079 I2879V probably benign Het
Lyst G T 13: 13,678,002 V2196L probably benign Het
Mettl5 T A 2: 69,881,373 I50F possibly damaging Het
Mmadhc A G 2: 50,296,329 probably benign Het
Msantd1 G A 5: 34,917,732 W46* probably null Het
Mto1 T C 9: 78,457,430 I317T probably damaging Het
Myef2 T G 2: 125,115,457 D126A probably damaging Het
Net1 A G 13: 3,887,569 probably null Het
Nnmt A T 9: 48,592,360 M122K probably benign Het
Nos1 A G 5: 117,949,784 K1371E probably benign Het
Nrcam G C 12: 44,590,148 W1121C probably damaging Het
Nt5c2 A G 19: 46,888,970 S511P Het
Olfr1246 A G 2: 89,590,917 F66S probably benign Het
Olfr1490 C A 19: 13,655,050 A207E probably damaging Het
Olfr267 T C 4: 58,785,585 I46V possibly damaging Het
Olfr346 G T 2: 36,688,766 V255F probably benign Het
P2rx7 A G 5: 122,652,797 K66E probably damaging Het
Paqr4 A G 17: 23,737,682 W236R probably damaging Het
Parm1 A G 5: 91,613,064 Y265C probably damaging Het
Pcbp2 T C 15: 102,484,193 Y178H probably damaging Het
Pidd1 G A 7: 141,441,765 P261S probably damaging Het
Pik3r6 T C 11: 68,551,333 V705A possibly damaging Het
Pla2g15 G T 8: 106,160,643 V156F possibly damaging Het
Prpf6 G A 2: 181,647,344 V609M possibly damaging Het
Rprd2 A G 3: 95,772,193 V491A probably benign Het
Rtp3 T A 9: 110,989,532 H27L probably damaging Het
Sema5b G A 16: 35,622,751 R42Q possibly damaging Het
Serpina3f A G 12: 104,217,484 K202E probably damaging Het
Slc25a33 T G 4: 149,749,310 M168L probably benign Het
Slc7a8 A G 14: 54,726,884 C371R probably damaging Het
Smyd1 T C 6: 71,215,824 N467S probably benign Het
Sptbn4 A G 7: 27,408,382 W872R probably damaging Het
Syne1 A T 10: 5,202,009 I5766N probably damaging Het
Syne2 A G 12: 75,939,986 S1699G probably benign Het
Synpo2 T C 3: 123,114,398 D423G possibly damaging Het
Tcf19 A T 17: 35,514,895 F122I probably damaging Het
Tdpoz4 A T 3: 93,796,914 T173S probably benign Het
Trappc8 T A 18: 20,850,918 H681L possibly damaging Het
Trim36 A G 18: 46,175,556 F413S probably benign Het
Tsks A G 7: 44,956,507 T466A possibly damaging Het
Ubr1 T C 2: 120,934,339 I545V probably benign Het
Ubr4 A G 4: 139,431,713 E1170G probably benign Het
Usp29 A G 7: 6,961,397 R80G possibly damaging Het
Utrn C T 10: 12,406,481 R3258H probably damaging Het
Vmn1r13 T G 6: 57,210,564 V236G probably benign Het
Vmn1r33 T A 6: 66,612,018 D184V probably damaging Het
Vmn2r87 T C 10: 130,479,925 N91D probably damaging Het
Wrn A G 8: 33,284,616 probably null Het
Zan G A 5: 137,463,374 P1181L unknown Het
Zfc3h1 C A 10: 115,423,457 L1645I possibly damaging Het
Zfhx2 G T 14: 55,064,734 P1931Q probably damaging Het
Zfp352 A G 4: 90,224,891 K423E probably benign Het
Zfp574 T A 7: 25,081,090 H512Q Het
Zfp651 C A 9: 121,762,924 Y103* probably null Het
Zfp7 G A 15: 76,890,331 R191H probably benign Het
Zfp771 A T 7: 127,245,129 K46* probably null Het
Zkscan8 T C 13: 21,520,593 E392G probably damaging Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43280269 nonsense probably null
IGL01341:Arhgef5 APN 6 43283991 missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43274028 missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43274604 missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43272411 missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43275130 missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43283982 missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43272935 nonsense probably null
IGL03292:Arhgef5 APN 6 43280246 missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43274000 missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43280651 missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43265621 splice site probably null
R0206:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43273396 missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43274634 missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43279515 missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43273403 missense probably benign
R1663:Arhgef5 UTSW 6 43276965 missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43280199 missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43288682 missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43283318 missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43274420 missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43273790 missense probably benign
R4205:Arhgef5 UTSW 6 43273832 missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43274093 missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43275099 missense probably benign
R4636:Arhgef5 UTSW 6 43274942 missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43283183 missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43273550 missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43273214 missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43273700 missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43265680 start gained probably benign
R5251:Arhgef5 UTSW 6 43272881 missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43272339 missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43274063 missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43275940 missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43275104 missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43275134 missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43275032 missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43274961 missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43280999 missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43273298 missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43274417 missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43275342 missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43288731 missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43275208 missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43273232 nonsense probably null
R7358:Arhgef5 UTSW 6 43279573 missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43280282 missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43280671 nonsense probably null
R7503:Arhgef5 UTSW 6 43273999 missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43273794 missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43275135 nonsense probably null
R7950:Arhgef5 UTSW 6 43273925 missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43283951 missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43280645 missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43275999 critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43287624 missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43284006 missense
R9610:Arhgef5 UTSW 6 43280956 missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43280956 missense probably damaging 0.99
R9685:Arhgef5 UTSW 6 43273593 missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43279473 missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43273701 missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43272408 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TAGTTCCTGACTCCACTGTGGC -3'
(R):5'- GGCAAAGATTCTGTTGATCTGC -3'

Sequencing Primer
(F):5'- TGACTCCACTGTGGCAAGGC -3'
(R):5'- CAAAGATTCTGTTGATCTGCCTGTG -3'
Posted On 2022-09-12