Incidental Mutation 'R0763:Atp8a1'
ID72499
Institutional Source Beutler Lab
Gene Symbol Atp8a1
Ensembl Gene ENSMUSG00000037685
Gene NameATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
SynonymsB230107D19Rik, Atp3a2
MMRRC Submission 038943-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0763 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location67618140-67847434 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67659883 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 920 (D920G)
Ref Sequence ENSEMBL: ENSMUSP00000118379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037380] [ENSMUST00000072971] [ENSMUST00000135930] [ENSMUST00000200955]
Predicted Effect probably benign
Transcript: ENSMUST00000037380
AA Change: D935G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042215
Gene: ENSMUSG00000037685
AA Change: D935G

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 9.8e-27 PFAM
Pfam:E1-E2_ATPase 106 371 3e-11 PFAM
Pfam:HAD 406 810 3.8e-23 PFAM
Pfam:Cation_ATPase 485 585 6e-14 PFAM
Pfam:PhoLip_ATPase_C 827 1079 8.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072971
AA Change: D935G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072738
Gene: ENSMUSG00000037685
AA Change: D935G

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 104 375 2.1e-22 PFAM
Pfam:Hydrolase 403 798 2.2e-14 PFAM
Pfam:HAD 406 795 3e-18 PFAM
Pfam:Hydrolase_like2 470 570 4.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135930
AA Change: D920G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118379
Gene: ENSMUSG00000037685
AA Change: D920G

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 1.1e-26 PFAM
Pfam:E1-E2_ATPase 106 371 8.6e-14 PFAM
Pfam:HAD 406 795 3.6e-23 PFAM
Pfam:Cation_ATPase 470 570 1.2e-13 PFAM
Pfam:PhoLip_ATPase_C 812 1064 8.4e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149501
Predicted Effect probably benign
Transcript: ENSMUST00000200955
SMART Domains Protein: ENSMUSP00000144465
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 7.5e-25 PFAM
Pfam:E1-E2_ATPase 106 371 3.7e-13 PFAM
Meta Mutation Damage Score 0.0687 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The P-type adenosinetriphosphatases (P-type ATPases) are a family of proteins which use the free energy of ATP hydrolysis to drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily catalyzes transport of heavy metal ions. Another subfamily transports non-heavy metal ions (NMHI). The protein encoded by this gene is a member of the third subfamily of P-type ATPases and acts to transport amphipaths, such as phosphatidylserine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable, fertile and phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,838,279 F290V probably damaging Het
Adam26b G A 8: 43,520,564 S467L probably damaging Het
Adgrv1 T A 13: 81,499,125 I3099F probably damaging Het
Akap6 A G 12: 53,142,214 D2137G possibly damaging Het
Arhgdig T C 17: 26,200,301 Y48C probably damaging Het
Astn1 A G 1: 158,509,890 I389V possibly damaging Het
BC016579 T A 16: 45,629,455 N200I probably damaging Het
Casc3 T C 11: 98,831,318 Y661H probably damaging Het
Cep120 A C 18: 53,721,737 V442G probably benign Het
Cfap65 A G 1: 74,904,682 Y1557H probably damaging Het
Chd2 G T 7: 73,447,274 Q1485K possibly damaging Het
Cntrl T C 2: 35,171,066 F1967L probably benign Het
Csmd1 G A 8: 17,027,284 T119M possibly damaging Het
Dnah9 T C 11: 66,155,530 H64R probably benign Het
Ep400 T C 5: 110,665,837 R2899G probably damaging Het
Fam205a1 A G 4: 42,851,238 V306A probably damaging Het
Foxl2 A C 9: 98,956,033 T125P probably damaging Het
Foxred1 A T 9: 35,207,473 probably null Het
H2-Eb1 T A 17: 34,314,159 probably benign Het
Heatr3 T C 8: 88,158,241 S378P probably damaging Het
Hectd4 T C 5: 121,307,033 probably benign Het
Hps3 T G 3: 20,003,279 R780S probably damaging Het
Ifi44 G A 3: 151,749,498 A30V probably damaging Het
Il12rb1 G A 8: 70,813,290 probably benign Het
Invs G A 4: 48,392,628 G281R possibly damaging Het
Itgax C A 7: 128,147,940 probably benign Het
Jade1 G T 3: 41,613,783 C762F possibly damaging Het
Lama1 C T 17: 67,772,818 P1229S probably damaging Het
Mmp15 C A 8: 95,368,228 D243E probably benign Het
Mug2 A G 6: 122,075,294 T1004A probably benign Het
Myh14 A T 7: 44,665,367 V44E probably damaging Het
N4bp2l1 C A 5: 150,594,404 R11S possibly damaging Het
Notch4 T A 17: 34,565,332 C36* probably null Het
Nwd1 A G 8: 72,671,044 D637G probably damaging Het
Ogfod1 T C 8: 94,055,636 I238T probably benign Het
Palm2 G A 4: 57,688,441 E95K probably damaging Het
Papln A G 12: 83,791,865 D1256G possibly damaging Het
Ppp1r26 T C 2: 28,450,367 L3P probably damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc17a5 A T 9: 78,553,090 probably benign Het
Slc25a17 A G 15: 81,323,706 probably benign Het
Socs4 T C 14: 47,290,655 F349S probably damaging Het
Tchhl1 A C 3: 93,471,571 E527D probably benign Het
Tm7sf3 A G 6: 146,606,289 L425S possibly damaging Het
Tmem266 G T 9: 55,414,955 V112L probably damaging Het
Tmem30c T A 16: 57,270,176 I223F possibly damaging Het
Tomm70a G A 16: 57,122,172 G104D probably benign Het
Ttc17 G T 2: 94,332,803 A834E probably benign Het
Ttn C T 2: 76,731,190 V20664M probably damaging Het
Zbed5 T C 5: 129,902,179 V323A probably benign Het
Other mutations in Atp8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Atp8a1 APN 5 67749143 missense probably benign 0.20
IGL00778:Atp8a1 APN 5 67659903 missense possibly damaging 0.58
IGL01068:Atp8a1 APN 5 67667337 missense probably benign 0.02
IGL01152:Atp8a1 APN 5 67847206 missense probably damaging 0.99
IGL01572:Atp8a1 APN 5 67667651 missense probably benign
IGL01608:Atp8a1 APN 5 67813136 nonsense probably null
IGL02171:Atp8a1 APN 5 67738465 missense probably damaging 1.00
IGL02330:Atp8a1 APN 5 67813177 missense probably damaging 0.98
IGL02381:Atp8a1 APN 5 67705995 missense probably benign
IGL02420:Atp8a1 APN 5 67682783 missense probably damaging 1.00
IGL02440:Atp8a1 APN 5 67667434 splice site probably benign
IGL02598:Atp8a1 APN 5 67682756 critical splice donor site probably null
IGL03259:Atp8a1 APN 5 67624006 splice site probably null
IGL03336:Atp8a1 APN 5 67729807 nonsense probably null
IGL03380:Atp8a1 APN 5 67732186 missense probably benign 0.25
PIT4131001:Atp8a1 UTSW 5 67622602 nonsense probably null
PIT4445001:Atp8a1 UTSW 5 67622660 missense
R0208:Atp8a1 UTSW 5 67774721 critical splice donor site probably null
R0276:Atp8a1 UTSW 5 67786673 splice site probably benign
R0279:Atp8a1 UTSW 5 67813092 splice site probably null
R0329:Atp8a1 UTSW 5 67812073 splice site probably benign
R0603:Atp8a1 UTSW 5 67756696 critical splice acceptor site probably null
R0715:Atp8a1 UTSW 5 67774725 missense probably benign 0.00
R1296:Atp8a1 UTSW 5 67622706 splice site probably benign
R1631:Atp8a1 UTSW 5 67749052 splice site probably null
R1764:Atp8a1 UTSW 5 67631567 missense probably benign 0.14
R1771:Atp8a1 UTSW 5 67647731 missense probably damaging 1.00
R1885:Atp8a1 UTSW 5 67747318 missense possibly damaging 0.82
R1897:Atp8a1 UTSW 5 67738429 missense probably damaging 1.00
R1968:Atp8a1 UTSW 5 67667657 missense probably benign 0.05
R2965:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R2966:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R4247:Atp8a1 UTSW 5 67667574 missense probably damaging 1.00
R4353:Atp8a1 UTSW 5 67769108 missense probably damaging 1.00
R4400:Atp8a1 UTSW 5 67764878 missense probably benign 0.13
R4426:Atp8a1 UTSW 5 67774828 missense probably benign 0.22
R4523:Atp8a1 UTSW 5 67667600 missense probably benign 0.00
R4576:Atp8a1 UTSW 5 67815815 intron probably benign
R4622:Atp8a1 UTSW 5 67682713 intron probably benign
R4639:Atp8a1 UTSW 5 67655974 missense probably benign 0.36
R4664:Atp8a1 UTSW 5 67762586 missense possibly damaging 0.92
R4732:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R4733:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R5071:Atp8a1 UTSW 5 67815723 missense probably benign 0.29
R5267:Atp8a1 UTSW 5 67762544 missense probably damaging 1.00
R5314:Atp8a1 UTSW 5 67705905 critical splice donor site probably null
R5424:Atp8a1 UTSW 5 67812100 missense probably damaging 1.00
R5588:Atp8a1 UTSW 5 67814684 missense probably damaging 1.00
R5698:Atp8a1 UTSW 5 67767153 missense probably benign 0.14
R5815:Atp8a1 UTSW 5 67749071 missense probably benign 0.00
R5977:Atp8a1 UTSW 5 67747285 missense possibly damaging 0.94
R6285:Atp8a1 UTSW 5 67667607 missense possibly damaging 0.68
R6341:Atp8a1 UTSW 5 67682927 missense possibly damaging 0.88
R6736:Atp8a1 UTSW 5 67667617 missense probably damaging 1.00
R6746:Atp8a1 UTSW 5 67751049 missense probably benign 0.00
R6887:Atp8a1 UTSW 5 67738451 missense probably benign 0.21
R6946:Atp8a1 UTSW 5 67622625 missense possibly damaging 0.50
R6970:Atp8a1 UTSW 5 67738462 missense probably damaging 1.00
R7035:Atp8a1 UTSW 5 67781030 missense probably benign 0.00
R7218:Atp8a1 UTSW 5 67702981 missense
R7278:Atp8a1 UTSW 5 67624037 missense
R7530:Atp8a1 UTSW 5 67745628 missense
R7548:Atp8a1 UTSW 5 67815728 nonsense probably null
R7594:Atp8a1 UTSW 5 67651592 missense
R7722:Atp8a1 UTSW 5 67622698 critical splice acceptor site probably null
R8152:Atp8a1 UTSW 5 67762582 missense
X0019:Atp8a1 UTSW 5 67749141 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AGCCCGTGAAAAGTGAGTTTTCCC -3'
(R):5'- GCATCTGGCTCTCTGGTGTAATGAC -3'

Sequencing Primer
(F):5'- CTGTCTGAAAAAGGCCATGTC -3'
(R):5'- GGCTCTCTGGTGTAATGACAAATATG -3'
Posted On2013-09-30