Incidental Mutation 'R9624:Sppl2b'
ID 725039
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Name signal peptide peptidase like 2B
Synonyms 3110056O03Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R9624 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 80691109-80704542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 80699373 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 269 (F269Y)
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
AlphaFold Q3TD49
Predicted Effect probably benign
Transcript: ENSMUST00000035597
AA Change: F269Y

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206
AA Change: F269Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect
Predicted Effect
Predicted Effect silent
Transcript: ENSMUST00000219951
Predicted Effect probably benign
Transcript: ENSMUST00000220091
AA Change: F117Y

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A T 12: 113,509,070 (GRCm39) N481I probably damaging Het
Ahnak T A 19: 8,989,846 (GRCm39) L3710Q unknown Het
Anapc15-ps T C 10: 95,508,965 (GRCm39) D105G probably benign Het
Ankfn1 T C 11: 89,414,033 (GRCm39) N114S probably benign Het
Ankrd27 A T 7: 35,301,891 (GRCm39) T137S possibly damaging Het
Atp1b3 A G 9: 96,222,293 (GRCm39) S165P probably benign Het
Atxn7l3 T C 11: 102,182,852 (GRCm39) D256G probably benign Het
B430305J03Rik C A 3: 61,271,408 (GRCm39) L112F unknown Het
Bub1 A T 2: 127,646,766 (GRCm39) I838K probably damaging Het
C3 T A 17: 57,527,189 (GRCm39) E753D probably benign Het
Cacnb4 T C 2: 52,364,942 (GRCm39) D107G probably benign Het
Cenpj A T 14: 56,802,387 (GRCm39) H59Q probably benign Het
Cxxc1 A T 18: 74,352,512 (GRCm39) H364L possibly damaging Het
Dapk1 T C 13: 60,895,937 (GRCm39) I675T probably benign Het
Eln A G 5: 134,738,991 (GRCm39) S663P unknown Het
Epha8 G T 4: 136,659,065 (GRCm39) P863Q probably damaging Het
Erich6 G T 3: 58,536,766 (GRCm39) T278N possibly damaging Het
Fam47e G C 5: 92,726,395 (GRCm39) R111P probably benign Het
Fam83g C T 11: 61,575,328 (GRCm39) probably benign Het
Fanci A T 7: 79,085,117 (GRCm39) I848L probably benign Het
Foxj3 T A 4: 119,483,589 (GRCm39) D620E unknown Het
Gm14443 T A 2: 175,012,129 (GRCm39) N106Y possibly damaging Het
Gm17654 T C 14: 43,815,492 (GRCm39) D105G Het
Gps1 C A 11: 120,677,434 (GRCm39) A216D probably damaging Het
Hs3st3b1 T C 11: 63,780,110 (GRCm39) K339R probably benign Het
Ikzf1 A G 11: 11,719,219 (GRCm39) T396A probably damaging Het
Lratd2 A T 15: 60,694,993 (GRCm39) I251N probably damaging Het
Lrrc9 A G 12: 72,497,586 (GRCm39) I135V probably benign Het
Mylk C A 16: 34,699,677 (GRCm39) Q347K probably benign Het
Myo1e A G 9: 70,303,156 (GRCm39) Y1059C probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Or10d1b A G 9: 39,613,822 (GRCm39) F81S probably benign Het
Or10j3 A T 1: 173,031,672 (GRCm39) I250F probably benign Het
Or2y1 T A 11: 49,385,834 (GRCm39) I158N possibly damaging Het
Or6c33 T C 10: 129,853,866 (GRCm39) V212A possibly damaging Het
Or8g23 T A 9: 38,971,453 (GRCm39) N170Y probably benign Het
Or8g30 G T 9: 39,230,848 (GRCm39) Q21K probably benign Het
Piezo2 G A 18: 63,197,767 (GRCm39) P1590S possibly damaging Het
Prl7a2 T A 13: 27,849,869 (GRCm39) K68* probably null Het
Prss33 A G 17: 24,054,656 (GRCm39) V14A probably benign Het
Rad17 T C 13: 100,773,503 (GRCm39) N162S probably damaging Het
Sbf2 A T 7: 109,963,857 (GRCm39) V1042E probably damaging Het
Scn1a A T 2: 66,153,766 (GRCm39) M689K probably benign Het
Senp7 A T 16: 55,990,075 (GRCm39) I608F probably damaging Het
Sh2b1 AGCTCAGCCACGGGGAC AGCTCAGCCACGGGGACACGCTCAGCCACGGGGAC 7: 126,066,750 (GRCm39) probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Sh2b1 GGGACCAGCTCAGCCACG GGGACCAGCTCAGCCACGTGGACCAGCTCAGCCACG 7: 126,066,744 (GRCm39) probably benign Het
Slc38a3 A G 9: 107,532,510 (GRCm39) V370A probably damaging Het
Sorbs2 A G 8: 46,228,690 (GRCm39) I307V possibly damaging Het
Spata13 C T 14: 60,944,349 (GRCm39) P581S probably benign Het
Spindoc G A 19: 7,352,197 (GRCm39) T50M probably benign Het
Stab1 C T 14: 30,863,345 (GRCm39) V2114M Het
Tcerg1l A G 7: 137,995,923 (GRCm39) V195A possibly damaging Het
Tent4a A T 13: 69,651,787 (GRCm39) W545R probably damaging Het
Tmem128 G T 5: 38,422,236 (GRCm39) R105L possibly damaging Het
Tns3 G A 11: 8,401,142 (GRCm39) T1052M possibly damaging Het
Vmn1r194 T A 13: 22,428,671 (GRCm39) I96N probably damaging Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Vmn1r78 G A 7: 11,886,410 (GRCm39) S7N probably benign Het
Wapl T A 14: 34,414,063 (GRCm39) N308K possibly damaging Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80,699,928 (GRCm39) missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80,701,175 (GRCm39) missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80,697,220 (GRCm39) missense probably benign 0.00
IGL01964:Sppl2b APN 10 80,701,220 (GRCm39) critical splice donor site probably null
IGL02376:Sppl2b APN 10 80,703,432 (GRCm39) nonsense probably null
R1641:Sppl2b UTSW 10 80,700,965 (GRCm39) missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80,701,451 (GRCm39) missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R3106:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R4350:Sppl2b UTSW 10 80,698,560 (GRCm39) missense probably benign 0.12
R5146:Sppl2b UTSW 10 80,703,474 (GRCm39) makesense probably null
R5698:Sppl2b UTSW 10 80,701,879 (GRCm39) splice site probably null
R6969:Sppl2b UTSW 10 80,700,959 (GRCm39) missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80,703,253 (GRCm39) missense probably benign 0.02
R8212:Sppl2b UTSW 10 80,701,193 (GRCm39) missense probably damaging 1.00
R8263:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8265:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8367:Sppl2b UTSW 10 80,699,025 (GRCm39) missense probably benign 0.02
R8398:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8398:Sppl2b UTSW 10 80,701,902 (GRCm39) frame shift probably null
R8400:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8480:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8481:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8505:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8817:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8818:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8832:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R9175:Sppl2b UTSW 10 80,698,807 (GRCm39) missense probably benign
Z1176:Sppl2b UTSW 10 80,703,259 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CCAGTCATGATCTGCGTGTTTG -3'
(R):5'- TGTGGCTCAGTTAGACAGGAAG -3'

Sequencing Primer
(F):5'- ACTTCTATGACCGCCTGGG -3'
(R):5'- CTCAGTTAGACAGGAAGGGGTATAC -3'
Posted On 2022-09-12