Incidental Mutation 'R0763:Mug2'
ID 72505
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Name murinoglobulin 2
Synonyms
MMRRC Submission 038943-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R0763 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 121983720-122062924 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 122052253 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1004 (T1004A)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
AlphaFold P28666
Predicted Effect probably benign
Transcript: ENSMUST00000081777
AA Change: T1004A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: T1004A

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,815,261 (GRCm39) F290V probably damaging Het
Adam26b G A 8: 43,973,601 (GRCm39) S467L probably damaging Het
Adgrv1 T A 13: 81,647,244 (GRCm39) I3099F probably damaging Het
Akap6 A G 12: 53,188,997 (GRCm39) D2137G possibly damaging Het
Arhgdig T C 17: 26,419,275 (GRCm39) Y48C probably damaging Het
Astn1 A G 1: 158,337,460 (GRCm39) I389V possibly damaging Het
Atp8a1 T C 5: 67,817,226 (GRCm39) D920G probably benign Het
BC016579 T A 16: 45,449,818 (GRCm39) N200I probably damaging Het
Casc3 T C 11: 98,722,144 (GRCm39) Y661H probably damaging Het
Cep120 A C 18: 53,854,809 (GRCm39) V442G probably benign Het
Cfap65 A G 1: 74,943,841 (GRCm39) Y1557H probably damaging Het
Chd2 G T 7: 73,097,022 (GRCm39) Q1485K possibly damaging Het
Cntrl T C 2: 35,061,078 (GRCm39) F1967L probably benign Het
Csmd1 G A 8: 17,077,300 (GRCm39) T119M possibly damaging Het
Dnah9 T C 11: 66,046,356 (GRCm39) H64R probably benign Het
Ep400 T C 5: 110,813,703 (GRCm39) R2899G probably damaging Het
Foxl2 A C 9: 98,838,086 (GRCm39) T125P probably damaging Het
Foxred1 A T 9: 35,118,769 (GRCm39) probably null Het
H2-Eb1 T A 17: 34,533,133 (GRCm39) probably benign Het
Heatr3 T C 8: 88,884,869 (GRCm39) S378P probably damaging Het
Hectd4 T C 5: 121,445,096 (GRCm39) probably benign Het
Hps3 T G 3: 20,057,443 (GRCm39) R780S probably damaging Het
Ifi44 G A 3: 151,455,135 (GRCm39) A30V probably damaging Het
Il12rb1 G A 8: 71,265,934 (GRCm39) probably benign Het
Invs G A 4: 48,392,628 (GRCm39) G281R possibly damaging Het
Itgax C A 7: 127,747,112 (GRCm39) probably benign Het
Jade1 G T 3: 41,568,218 (GRCm39) C762F possibly damaging Het
Lama1 C T 17: 68,079,813 (GRCm39) P1229S probably damaging Het
Mmp15 C A 8: 96,094,856 (GRCm39) D243E probably benign Het
Myh14 A T 7: 44,314,791 (GRCm39) V44E probably damaging Het
N4bp2l1 C A 5: 150,517,869 (GRCm39) R11S possibly damaging Het
Notch4 T A 17: 34,784,306 (GRCm39) C36* probably null Het
Nwd1 A G 8: 73,397,672 (GRCm39) D637G probably damaging Het
Ogfod1 T C 8: 94,782,264 (GRCm39) I238T probably benign Het
Pakap G A 4: 57,688,441 (GRCm39) E95K probably damaging Het
Papln A G 12: 83,838,639 (GRCm39) D1256G possibly damaging Het
Ppp1r26 T C 2: 28,340,379 (GRCm39) L3P probably damaging Het
Rbm10 C T X: 20,503,903 (GRCm39) probably benign Het
Slc17a5 A T 9: 78,460,372 (GRCm39) probably benign Het
Slc25a17 A G 15: 81,207,907 (GRCm39) probably benign Het
Socs4 T C 14: 47,528,112 (GRCm39) F349S probably damaging Het
Spata31f1a A G 4: 42,851,238 (GRCm39) V306A probably damaging Het
Tchhl1 A C 3: 93,378,878 (GRCm39) E527D probably benign Het
Tm7sf3 A G 6: 146,507,787 (GRCm39) L425S possibly damaging Het
Tmem266 G T 9: 55,322,239 (GRCm39) V112L probably damaging Het
Tmem30c T A 16: 57,090,539 (GRCm39) I223F possibly damaging Het
Tomm70a G A 16: 56,942,535 (GRCm39) G104D probably benign Het
Ttc17 G T 2: 94,163,148 (GRCm39) A834E probably benign Het
Ttn C T 2: 76,561,534 (GRCm39) V20664M probably damaging Het
Zbed5 T C 5: 129,931,020 (GRCm39) V323A probably benign Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122,024,446 (GRCm39) missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122,017,613 (GRCm39) missense probably damaging 0.99
IGL01314:Mug2 APN 6 122,058,238 (GRCm39) missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122,026,587 (GRCm39) splice site probably benign
IGL01477:Mug2 APN 6 122,058,643 (GRCm39) splice site probably benign
IGL01926:Mug2 APN 6 122,013,063 (GRCm39) splice site probably benign
IGL02019:Mug2 APN 6 122,024,394 (GRCm39) missense probably benign 0.02
IGL02305:Mug2 APN 6 122,013,015 (GRCm39) missense probably benign
IGL02310:Mug2 APN 6 122,036,082 (GRCm39) splice site probably benign
IGL02484:Mug2 APN 6 122,049,712 (GRCm39) missense probably damaging 1.00
IGL02516:Mug2 APN 6 122,047,802 (GRCm39) missense probably damaging 1.00
IGL02531:Mug2 APN 6 122,049,730 (GRCm39) missense probably damaging 1.00
IGL02666:Mug2 APN 6 122,058,285 (GRCm39) missense probably damaging 1.00
IGL02936:Mug2 APN 6 122,058,346 (GRCm39) critical splice donor site probably null
R0114:Mug2 UTSW 6 122,017,607 (GRCm39) missense probably damaging 1.00
R0119:Mug2 UTSW 6 122,013,022 (GRCm39) missense probably benign 0.00
R0123:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122,047,970 (GRCm39) splice site probably benign
R0225:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122,058,558 (GRCm39) missense probably damaging 1.00
R0959:Mug2 UTSW 6 122,062,454 (GRCm39) missense probably benign 0.33
R1104:Mug2 UTSW 6 122,036,014 (GRCm39) missense probably benign
R1239:Mug2 UTSW 6 122,058,637 (GRCm39) splice site probably benign
R1318:Mug2 UTSW 6 122,054,361 (GRCm39) missense probably damaging 1.00
R1460:Mug2 UTSW 6 122,017,492 (GRCm39) splice site probably benign
R1706:Mug2 UTSW 6 122,013,191 (GRCm39) splice site probably benign
R1761:Mug2 UTSW 6 122,051,664 (GRCm39) missense probably benign 0.20
R1901:Mug2 UTSW 6 122,048,801 (GRCm39) missense probably benign 0.02
R1913:Mug2 UTSW 6 122,047,829 (GRCm39) missense probably damaging 1.00
R1943:Mug2 UTSW 6 122,056,598 (GRCm39) missense probably benign
R2054:Mug2 UTSW 6 122,054,451 (GRCm39) missense probably damaging 1.00
R2060:Mug2 UTSW 6 122,056,571 (GRCm39) missense probably benign
R2420:Mug2 UTSW 6 122,060,419 (GRCm39) missense probably damaging 1.00
R2432:Mug2 UTSW 6 122,061,335 (GRCm39) missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R2918:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R3423:Mug2 UTSW 6 122,024,465 (GRCm39) splice site probably benign
R3834:Mug2 UTSW 6 122,026,746 (GRCm39) critical splice donor site probably null
R3902:Mug2 UTSW 6 122,052,526 (GRCm39) missense probably damaging 1.00
R3941:Mug2 UTSW 6 122,040,522 (GRCm39) missense probably benign
R4227:Mug2 UTSW 6 122,017,691 (GRCm39) missense probably benign 0.10
R4284:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4287:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4377:Mug2 UTSW 6 122,047,966 (GRCm39) critical splice donor site probably null
R4419:Mug2 UTSW 6 122,056,589 (GRCm39) missense probably damaging 1.00
R4498:Mug2 UTSW 6 122,059,711 (GRCm39) missense probably damaging 0.99
R4566:Mug2 UTSW 6 122,056,597 (GRCm39) missense probably benign 0.00
R4690:Mug2 UTSW 6 122,013,255 (GRCm39) missense probably benign
R4732:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4733:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4741:Mug2 UTSW 6 122,056,572 (GRCm39) missense probably benign
R4888:Mug2 UTSW 6 122,058,154 (GRCm39) missense probably damaging 1.00
R5199:Mug2 UTSW 6 122,017,619 (GRCm39) missense probably benign
R5347:Mug2 UTSW 6 122,058,551 (GRCm39) missense probably damaging 1.00
R5457:Mug2 UTSW 6 122,026,688 (GRCm39) nonsense probably null
R5495:Mug2 UTSW 6 122,056,609 (GRCm39) missense probably damaging 0.96
R5509:Mug2 UTSW 6 122,061,340 (GRCm39) missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122,060,459 (GRCm39) missense probably null 0.98
R6180:Mug2 UTSW 6 122,056,565 (GRCm39) missense probably benign 0.01
R6184:Mug2 UTSW 6 122,014,005 (GRCm39) missense probably benign
R6199:Mug2 UTSW 6 122,024,398 (GRCm39) missense probably benign 0.05
R6262:Mug2 UTSW 6 122,052,214 (GRCm39) missense probably damaging 1.00
R6416:Mug2 UTSW 6 122,059,713 (GRCm39) missense probably damaging 1.00
R6548:Mug2 UTSW 6 122,024,401 (GRCm39) missense probably damaging 1.00
R6703:Mug2 UTSW 6 122,055,653 (GRCm39) missense probably benign 0.25
R7106:Mug2 UTSW 6 122,059,680 (GRCm39) missense probably damaging 1.00
R7131:Mug2 UTSW 6 122,052,206 (GRCm39) missense probably damaging 1.00
R7372:Mug2 UTSW 6 122,060,425 (GRCm39) missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122,024,446 (GRCm39) missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122,017,529 (GRCm39) missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122,056,685 (GRCm39) missense probably benign 0.00
R7581:Mug2 UTSW 6 122,040,670 (GRCm39) missense probably damaging 1.00
R7582:Mug2 UTSW 6 122,056,603 (GRCm39) missense probably damaging 0.99
R7672:Mug2 UTSW 6 122,017,678 (GRCm39) missense probably benign 0.37
R7713:Mug2 UTSW 6 122,055,754 (GRCm39) missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122,058,317 (GRCm39) missense probably damaging 1.00
R7834:Mug2 UTSW 6 122,013,241 (GRCm39) missense probably benign
R7850:Mug2 UTSW 6 122,052,170 (GRCm39) missense probably damaging 1.00
R8029:Mug2 UTSW 6 122,058,504 (GRCm39) critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122,052,567 (GRCm39) missense probably benign 0.01
R8335:Mug2 UTSW 6 122,017,543 (GRCm39) missense probably benign
R8348:Mug2 UTSW 6 122,049,192 (GRCm39) nonsense probably null
R8557:Mug2 UTSW 6 122,040,660 (GRCm39) missense probably damaging 0.99
R8798:Mug2 UTSW 6 122,058,569 (GRCm39) missense probably damaging 1.00
R8823:Mug2 UTSW 6 122,040,648 (GRCm39) missense possibly damaging 0.89
R9029:Mug2 UTSW 6 122,061,328 (GRCm39) missense probably damaging 1.00
R9153:Mug2 UTSW 6 122,017,627 (GRCm39) missense possibly damaging 0.71
R9185:Mug2 UTSW 6 122,054,442 (GRCm39) missense probably benign 0.06
R9186:Mug2 UTSW 6 122,052,248 (GRCm39) missense probably damaging 0.99
R9418:Mug2 UTSW 6 122,017,700 (GRCm39) missense probably benign 0.00
R9464:Mug2 UTSW 6 122,028,690 (GRCm39) missense probably benign 0.01
R9622:Mug2 UTSW 6 122,028,751 (GRCm39) missense probably benign 0.29
Z1177:Mug2 UTSW 6 122,014,080 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTCCCACTGGCTTCTAGCACAC -3'
(R):5'- ATCTGAAGGCAGAAAGGCCCTCAC -3'

Sequencing Primer
(F):5'- cccacccactcccacttc -3'
(R):5'- AGGCCCTCACATACCCTGG -3'
Posted On 2013-09-30