Incidental Mutation 'R9624:Mylk'
ID 725063
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9624 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 34745210-35002420 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 34879307 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 347 (Q347K)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023538
AA Change: Q347K

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: Q347K

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A T 12: 113,545,450 N481I probably damaging Het
Ahnak T A 19: 9,012,482 L3710Q unknown Het
Anapc15-ps T C 10: 95,673,103 D105G probably benign Het
Ankfn1 T C 11: 89,523,207 N114S probably benign Het
Ankrd27 A T 7: 35,602,466 T137S possibly damaging Het
Atp1b3 A G 9: 96,340,240 S165P probably benign Het
Atxn7l3 T C 11: 102,292,026 D256G probably benign Het
B430305J03Rik C A 3: 61,363,987 L112F unknown Het
Bub1 A T 2: 127,804,846 I838K probably damaging Het
C3 T A 17: 57,220,189 E753D probably benign Het
Cacnb4 T C 2: 52,474,930 D107G probably benign Het
Cenpj A T 14: 56,564,930 H59Q probably benign Het
Cxxc1 A T 18: 74,219,441 H364L possibly damaging Het
Dapk1 T C 13: 60,748,123 I675T probably benign Het
Eln A G 5: 134,710,137 S663P unknown Het
Epha8 G T 4: 136,931,754 P863Q probably damaging Het
Erich6 G T 3: 58,629,345 T278N possibly damaging Het
Fam47e G C 5: 92,578,536 R111P probably benign Het
Fam83g C T 11: 61,684,502 probably benign Het
Fam84b A T 15: 60,823,144 I251N probably damaging Het
Fanci A T 7: 79,435,369 I848L probably benign Het
Foxj3 T A 4: 119,626,392 D620E unknown Het
Gm14443 T A 2: 175,170,336 N106Y possibly damaging Het
Gm17654 T C 14: 43,578,035 D105G Het
Gps1 C A 11: 120,786,608 A216D probably damaging Het
Hs3st3b1 T C 11: 63,889,284 K339R probably benign Het
Ikzf1 A G 11: 11,769,219 T396A probably damaging Het
Lrrc9 A G 12: 72,450,812 I135V probably benign Het
Myo1e A G 9: 70,395,874 Y1059C probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Olfr1385 T A 11: 49,495,007 I158N possibly damaging Het
Olfr149 A G 9: 39,702,526 F81S probably benign Het
Olfr218 A T 1: 173,204,105 I250F probably benign Het
Olfr820 T C 10: 130,017,997 V212A possibly damaging Het
Olfr937 T A 9: 39,060,157 N170Y probably benign Het
Olfr948 G T 9: 39,319,552 Q21K probably benign Het
Papd7 A T 13: 69,503,668 W545R probably damaging Het
Piezo2 G A 18: 63,064,696 P1590S possibly damaging Het
Prl7a2 T A 13: 27,665,886 K68* probably null Het
Prss33 A G 17: 23,835,682 V14A probably benign Het
Rad17 T C 13: 100,636,995 N162S probably damaging Het
Sbf2 A T 7: 110,364,650 V1042E probably damaging Het
Scn1a A T 2: 66,323,422 M689K probably benign Het
Senp7 A T 16: 56,169,712 I608F probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGGACCAGCTCAGCCACG GGGACCAGCTCAGCCACGTGGACCAGCTCAGCCACG 7: 126,467,572 probably benign Het
Sh2b1 AGCTCAGCCACGGGGAC AGCTCAGCCACGGGGACACGCTCAGCCACGGGGAC 7: 126,467,578 probably benign Het
Slc38a3 A G 9: 107,655,311 V370A probably damaging Het
Sorbs2 A G 8: 45,775,653 I307V possibly damaging Het
Spata13 C T 14: 60,706,900 P581S probably benign Het
Spindoc G A 19: 7,374,832 T50M probably benign Het
Sppl2b T A 10: 80,863,539 F269Y probably benign Het
Stab1 C T 14: 31,141,388 V2114M Het
Tcerg1l A G 7: 138,394,194 V195A possibly damaging Het
Tmem128 G T 5: 38,264,892 R105L possibly damaging Het
Tns3 G A 11: 8,451,142 T1052M possibly damaging Het
Vmn1r194 T A 13: 22,244,501 I96N probably damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn1r78 G A 7: 12,152,483 S7N probably benign Het
Wapl T A 14: 34,692,106 N308K possibly damaging Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34938952 missense probably benign 0.36
IGL01386:Mylk APN 16 34971240 critical splice acceptor site probably null
IGL01684:Mylk APN 16 34971940 missense possibly damaging 0.55
IGL01884:Mylk APN 16 34988877 splice site probably benign
IGL02079:Mylk APN 16 34860631 missense possibly damaging 0.87
IGL02104:Mylk APN 16 34815435 missense probably benign 0.06
IGL02624:Mylk APN 16 34929896 missense probably benign 0.29
IGL02756:Mylk APN 16 34963646 missense probably benign 0.42
IGL02794:Mylk APN 16 34986541 missense probably benign 0.21
IGL02833:Mylk APN 16 34914900 missense probably benign 0.01
IGL02946:Mylk APN 16 34921788 missense probably benign 0.10
IGL03012:Mylk APN 16 34952781 missense probably benign 0.03
IGL03093:Mylk APN 16 34912192 missense possibly damaging 0.62
IGL03272:Mylk APN 16 34979189 missense probably benign 0.09
billy UTSW 16 34875620 missense probably damaging 0.97
brutus UTSW 16 34953695 missense probably benign 0.12
Club UTSW 16 34912275 nonsense probably null
popeye UTSW 16 34963577 missense probably benign 0.29
F5770:Mylk UTSW 16 34995204 critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34977113 splice site probably benign
PIT4382001:Mylk UTSW 16 34875642 missense probably damaging 0.99
R0131:Mylk UTSW 16 34875504 missense probably benign 0.03
R0309:Mylk UTSW 16 34912297 splice site probably benign
R0358:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0381:Mylk UTSW 16 34784974 splice site probably null
R0390:Mylk UTSW 16 34875620 missense probably damaging 0.97
R0413:Mylk UTSW 16 34921944 missense probably benign 0.01
R0536:Mylk UTSW 16 35000387 missense possibly damaging 0.95
R0544:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0545:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0546:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0547:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0548:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0627:Mylk UTSW 16 35000429 missense probably damaging 1.00
R0726:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0755:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0782:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0783:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0784:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1136:Mylk UTSW 16 35000318 missense probably damaging 1.00
R1170:Mylk UTSW 16 34874039 missense probably benign 0.20
R1222:Mylk UTSW 16 34860652 missense probably benign 0.12
R1445:Mylk UTSW 16 34815465 missense possibly damaging 0.57
R1583:Mylk UTSW 16 34875586 missense probably benign 0.29
R1618:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1643:Mylk UTSW 16 34875635 missense probably benign 0.03
R1702:Mylk UTSW 16 34921944 missense probably benign 0.00
R1776:Mylk UTSW 16 34952782 missense probably benign 0.16
R1865:Mylk UTSW 16 34912230 missense probably benign 0.03
R1975:Mylk UTSW 16 34880303 splice site probably null
R2016:Mylk UTSW 16 34996817 missense probably damaging 1.00
R2045:Mylk UTSW 16 34953653 missense probably benign 0.29
R2134:Mylk UTSW 16 34986476 missense probably benign 0.13
R3547:Mylk UTSW 16 34880168 missense possibly damaging 0.61
R3844:Mylk UTSW 16 34921877 missense probably benign 0.01
R4003:Mylk UTSW 16 34963577 missense probably benign 0.29
R4396:Mylk UTSW 16 34912275 nonsense probably null
R4470:Mylk UTSW 16 34912152 missense probably benign 0.09
R4507:Mylk UTSW 16 34953695 missense probably benign 0.12
R4700:Mylk UTSW 16 34922435 missense probably benign 0.16
R4751:Mylk UTSW 16 34879169 missense probably benign 0.29
R4815:Mylk UTSW 16 34894925 missense probably damaging 0.97
R4832:Mylk UTSW 16 34922367 missense probably benign 0.36
R4872:Mylk UTSW 16 34914990 missense possibly damaging 0.89
R4953:Mylk UTSW 16 34988961 missense probably damaging 1.00
R4969:Mylk UTSW 16 34971440 missense probably damaging 0.96
R5009:Mylk UTSW 16 34899507 missense probably benign 0.39
R5130:Mylk UTSW 16 34988997 missense probably damaging 1.00
R5173:Mylk UTSW 16 34977013 missense probably benign 0.40
R5195:Mylk UTSW 16 34979215 missense probably damaging 1.00
R5209:Mylk UTSW 16 34922625 missense possibly damaging 0.55
R5311:Mylk UTSW 16 34921757 missense probably benign 0.01
R5418:Mylk UTSW 16 34912230 missense probably benign 0.02
R5481:Mylk UTSW 16 34921604 missense probably benign 0.09
R5590:Mylk UTSW 16 34879352 missense probably benign 0.29
R5603:Mylk UTSW 16 34956492 missense probably benign 0.06
R5823:Mylk UTSW 16 34894947 critical splice donor site probably null
R6290:Mylk UTSW 16 34894843 missense probably benign 0.39
R6351:Mylk UTSW 16 34921971 missense probably benign 0.01
R6365:Mylk UTSW 16 34860591 missense probably benign 0.12
R6490:Mylk UTSW 16 34929867 missense possibly damaging 0.74
R6723:Mylk UTSW 16 34929888 missense possibly damaging 0.74
R6864:Mylk UTSW 16 34874150 missense probably benign 0.03
R6908:Mylk UTSW 16 34880273 missense probably benign 0.18
R6949:Mylk UTSW 16 35000318 missense probably damaging 1.00
R7018:Mylk UTSW 16 35000426 missense possibly damaging 0.88
R7035:Mylk UTSW 16 34976982 missense possibly damaging 0.89
R7162:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7236:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7269:Mylk UTSW 16 34785011 missense probably damaging 0.96
R7475:Mylk UTSW 16 34914076 splice site probably null
R7525:Mylk UTSW 16 34988987 missense probably benign 0.06
R7587:Mylk UTSW 16 34922517 missense probably benign 0.29
R7607:Mylk UTSW 16 34894814 missense probably benign 0.09
R7616:Mylk UTSW 16 34879557 missense probably damaging 0.97
R7647:Mylk UTSW 16 34879524 missense probably benign 0.29
R7648:Mylk UTSW 16 34879524 missense probably benign 0.29
R7764:Mylk UTSW 16 34922183 missense probably benign 0.16
R7890:Mylk UTSW 16 34963648 nonsense probably null
R7892:Mylk UTSW 16 34879524 missense probably benign 0.29
R7893:Mylk UTSW 16 34879524 missense probably benign 0.29
R8065:Mylk UTSW 16 34972019 missense probably benign 0.08
R8067:Mylk UTSW 16 34972019 missense probably benign 0.08
R8143:Mylk UTSW 16 34914155 missense possibly damaging 0.87
R8210:Mylk UTSW 16 35000351 missense probably damaging 1.00
R8271:Mylk UTSW 16 34922579 missense probably damaging 0.97
R8540:Mylk UTSW 16 34929887 missense possibly damaging 0.87
R8721:Mylk UTSW 16 34996806 missense probably damaging 1.00
R8743:Mylk UTSW 16 34921057 missense probably benign 0.03
R8798:Mylk UTSW 16 34899402 missense possibly damaging 0.89
R8956:Mylk UTSW 16 34971409 missense probably benign 0.01
R9131:Mylk UTSW 16 34956465 missense probably benign 0.29
R9403:Mylk UTSW 16 34875642 nonsense probably null
R9735:Mylk UTSW 16 34914809 missense probably benign 0.09
R9756:Mylk UTSW 16 34914017 missense probably damaging 0.96
R9763:Mylk UTSW 16 34879112 nonsense probably null
RF001:Mylk UTSW 16 34879371 missense probably benign 0.03
V7580:Mylk UTSW 16 34995204 critical splice donor site probably null
V7583:Mylk UTSW 16 34995204 critical splice donor site probably null
X0065:Mylk UTSW 16 35000441 missense probably damaging 1.00
Z1177:Mylk UTSW 16 34922651 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AAAGACCCAGAGACTGTGGC -3'
(R):5'- GGGGCTGACTCTCAAATCTG -3'

Sequencing Primer
(F):5'- CTGTGGCTGAAAGTAAGAACTGTCC -3'
(R):5'- CAAATCTGGGGAATGTTGACTCCC -3'
Posted On 2022-09-12