Incidental Mutation 'R9625:Ptpro'
ID 725088
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Name protein tyrosine phosphatase receptor type O
Synonyms Ptpn15, PTP-BK, D28, PTPROt, PTP-phi, PTP-U2, GLEPP1, PTP-oc
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9625 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 137229317-137440231 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 137371873 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 630 (C630F)
Ref Sequence ENSEMBL: ENSMUSP00000076364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167679]
AlphaFold E9Q612
Predicted Effect probably damaging
Transcript: ENSMUST00000077115
AA Change: C630F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: C630F

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167679
AA Change: C630F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: C630F

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A G 3: 121,465,033 (GRCm39) E23G unknown Het
Abhd5 A G 9: 122,208,606 (GRCm39) Y332C probably damaging Het
Adcyap1r1 A T 6: 55,457,055 (GRCm39) E262V probably damaging Het
Adgre5 A G 8: 84,450,658 (GRCm39) Y793H probably damaging Het
Arhgef33 A T 17: 80,654,707 (GRCm39) Y78F possibly damaging Het
Asl G A 5: 130,047,693 (GRCm39) A91V probably damaging Het
Cd40 A T 2: 164,905,061 (GRCm39) I126F probably benign Het
Ceacam10 A G 7: 24,476,705 (GRCm39) E2G probably damaging Het
Cfap46 C T 7: 139,230,805 (GRCm39) R941H Het
Cntnap3 A T 13: 65,006,579 (GRCm39) S78T probably damaging Het
Cntnap4 T C 8: 113,602,181 (GRCm39) V1195A possibly damaging Het
Cthrc1 T C 15: 38,947,874 (GRCm39) S198P probably damaging Het
Dcaf7 T G 11: 105,942,794 (GRCm39) probably null Het
Dhx16 A G 17: 36,193,413 (GRCm39) E252G probably benign Het
Efcab2 C T 1: 178,302,505 (GRCm39) T83I possibly damaging Het
Efhc1 A G 1: 21,049,738 (GRCm39) N533D probably benign Het
Emilin2 A G 17: 71,581,112 (GRCm39) V538A probably benign Het
Fam171b A T 2: 83,683,914 (GRCm39) T144S probably damaging Het
Fam98a A G 17: 75,845,474 (GRCm39) F424S unknown Het
Gm3573 T C 14: 42,011,605 (GRCm39) R42G possibly damaging Het
Gpr143 GTTTTTT GTTTTTTT X: 151,578,627 (GRCm39) probably null Het
H2-K2 G A 17: 34,218,975 (GRCm39) P23S probably benign Het
Hormad2 G A 11: 4,377,372 (GRCm39) P22L probably damaging Het
Hoxb1 C T 11: 96,256,810 (GRCm39) A53V probably benign Het
Kalrn T A 16: 33,849,197 (GRCm39) probably null Het
Kdm2a C T 19: 4,393,141 (GRCm39) D405N Het
Kif1a C T 1: 93,000,766 (GRCm39) E287K probably benign Het
Lrrk1 A T 7: 65,909,666 (GRCm39) *2015K probably null Het
Ltbp1 G T 17: 75,486,157 (GRCm39) G61C probably damaging Het
Mthfd2l A G 5: 91,107,567 (GRCm39) H143R probably damaging Het
Myo1d C A 11: 80,448,296 (GRCm39) G943V possibly damaging Het
Ncoa1 T A 12: 4,345,643 (GRCm39) Q568L probably damaging Het
Ncoa3 G A 2: 165,899,130 (GRCm39) S824N probably benign Het
Nfe2l3 A T 6: 51,434,925 (GRCm39) D495V probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nlrp14 A G 7: 106,782,169 (GRCm39) I455M probably benign Het
Npb T C 11: 120,499,375 (GRCm39) L14P probably damaging Het
Or51f1 C T 7: 102,505,636 (GRCm39) M284I probably benign Het
P2ry12 G A 3: 59,125,496 (GRCm39) R60C possibly damaging Het
Pcdhb17 T A 18: 37,619,419 (GRCm39) L403* probably null Het
Phb2 G A 6: 124,690,974 (GRCm39) R44H probably damaging Het
Plekha5 A T 6: 140,372,253 (GRCm39) T68S probably benign Het
Ptprg C T 14: 12,152,027 (GRCm38) R447W probably damaging Het
Ptprk T C 10: 28,462,006 (GRCm39) Y1190H probably damaging Het
Rrp15 G T 1: 186,453,718 (GRCm39) P243Q possibly damaging Het
Smurf1 A G 5: 144,830,920 (GRCm39) F285S possibly damaging Het
Spata13 C T 14: 60,944,349 (GRCm39) P581S probably benign Het
Tex44 T C 1: 86,354,253 (GRCm39) I54T unknown Het
Tom1l2 A G 11: 60,161,277 (GRCm39) V78A probably damaging Het
Vps11 A G 9: 44,265,738 (GRCm39) W514R probably damaging Het
Wnk2 C A 13: 49,254,445 (GRCm39) V357L probably benign Het
Zfp970 C T 2: 177,167,790 (GRCm39) Q455* probably null Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137,371,907 (GRCm39) critical splice donor site probably null
IGL00844:Ptpro APN 6 137,391,237 (GRCm39) missense probably damaging 1.00
IGL00983:Ptpro APN 6 137,395,246 (GRCm39) missense probably benign 0.01
IGL01073:Ptpro APN 6 137,354,086 (GRCm39) missense probably damaging 1.00
IGL01832:Ptpro APN 6 137,370,666 (GRCm39) missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137,431,698 (GRCm39) missense probably benign 0.37
IGL02387:Ptpro APN 6 137,387,978 (GRCm39) missense probably damaging 0.96
IGL02605:Ptpro APN 6 137,357,316 (GRCm39) missense probably benign 0.02
IGL02666:Ptpro APN 6 137,355,057 (GRCm39) missense probably damaging 0.96
IGL03275:Ptpro APN 6 137,427,004 (GRCm39) missense probably damaging 1.00
Brau UTSW 6 137,431,596 (GRCm39) missense probably damaging 1.00
court UTSW 6 137,370,673 (GRCm39) nonsense probably null
Hoff UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
Jester UTSW 6 137,426,915 (GRCm39) missense probably damaging 1.00
mann UTSW 6 137,388,114 (GRCm39) splice site probably null
R0017:Ptpro UTSW 6 137,393,825 (GRCm39) missense probably benign 0.03
R0017:Ptpro UTSW 6 137,393,825 (GRCm39) missense probably benign 0.03
R0020:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0022:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0023:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0024:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0094:Ptpro UTSW 6 137,363,350 (GRCm39) missense probably benign 0.08
R0094:Ptpro UTSW 6 137,363,350 (GRCm39) missense probably benign 0.08
R0103:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0106:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0316:Ptpro UTSW 6 137,353,987 (GRCm39) missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137,345,294 (GRCm39) missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137,391,228 (GRCm39) missense probably benign 0.04
R0536:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0537:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0552:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0555:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0664:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0708:Ptpro UTSW 6 137,363,251 (GRCm39) missense probably benign 0.26
R0730:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0735:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0738:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0786:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0811:Ptpro UTSW 6 137,345,077 (GRCm39) missense probably benign 0.00
R0812:Ptpro UTSW 6 137,345,077 (GRCm39) missense probably benign 0.00
R0881:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0973:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1145:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1145:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1146:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1146:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1147:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1147:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1259:Ptpro UTSW 6 137,369,739 (GRCm39) missense probably damaging 0.98
R1340:Ptpro UTSW 6 137,418,079 (GRCm39) missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1382:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1385:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1396:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1401:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1416:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1422:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1448:Ptpro UTSW 6 137,418,114 (GRCm39) missense probably damaging 1.00
R1513:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1518:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1526:Ptpro UTSW 6 137,438,724 (GRCm39) missense probably damaging 1.00
R1540:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1571:Ptpro UTSW 6 137,355,128 (GRCm39) missense probably benign
R1573:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1587:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1588:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1649:Ptpro UTSW 6 137,421,015 (GRCm39) nonsense probably null
R1700:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1701:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1745:Ptpro UTSW 6 137,377,643 (GRCm39) missense probably benign 0.03
R1772:Ptpro UTSW 6 137,407,741 (GRCm39) missense probably damaging 1.00
R1911:Ptpro UTSW 6 137,377,617 (GRCm39) splice site probably benign
R1958:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1967:Ptpro UTSW 6 137,393,863 (GRCm39) missense probably benign 0.38
R2025:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2026:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2040:Ptpro UTSW 6 137,363,162 (GRCm39) splice site probably benign
R2115:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2117:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2130:Ptpro UTSW 6 137,388,114 (GRCm39) splice site probably null
R2161:Ptpro UTSW 6 137,426,885 (GRCm39) missense probably benign 0.01
R2431:Ptpro UTSW 6 137,420,583 (GRCm39) nonsense probably null
R2915:Ptpro UTSW 6 137,391,239 (GRCm39) start gained probably benign
R2988:Ptpro UTSW 6 137,420,597 (GRCm39) nonsense probably null
R3772:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3773:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3795:Ptpro UTSW 6 137,357,307 (GRCm39) missense probably benign
R3885:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3886:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3887:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3888:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3893:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R4032:Ptpro UTSW 6 137,438,740 (GRCm39) missense probably damaging 1.00
R4133:Ptpro UTSW 6 137,397,370 (GRCm39) missense probably damaging 1.00
R4377:Ptpro UTSW 6 137,357,264 (GRCm39) missense probably benign 0.26
R4455:Ptpro UTSW 6 137,370,657 (GRCm39) missense probably damaging 1.00
R4613:Ptpro UTSW 6 137,393,834 (GRCm39) nonsense probably null
R4827:Ptpro UTSW 6 137,419,708 (GRCm39) missense probably damaging 1.00
R4863:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R4870:Ptpro UTSW 6 137,354,130 (GRCm39) missense probably damaging 0.96
R4910:Ptpro UTSW 6 137,345,336 (GRCm39) missense probably damaging 0.99
R4932:Ptpro UTSW 6 137,388,103 (GRCm39) nonsense probably null
R4941:Ptpro UTSW 6 137,369,763 (GRCm39) missense probably damaging 1.00
R4989:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5009:Ptpro UTSW 6 137,354,130 (GRCm39) missense probably damaging 0.96
R5032:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5033:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5162:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5393:Ptpro UTSW 6 137,357,222 (GRCm39) missense probably benign 0.04
R5423:Ptpro UTSW 6 137,419,705 (GRCm39) missense probably damaging 1.00
R5782:Ptpro UTSW 6 137,376,496 (GRCm39) missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137,377,704 (GRCm39) missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137,357,606 (GRCm39) missense probably benign 0.28
R6488:Ptpro UTSW 6 137,370,673 (GRCm39) nonsense probably null
R6494:Ptpro UTSW 6 137,359,640 (GRCm39) missense probably benign 0.20
R6746:Ptpro UTSW 6 137,371,821 (GRCm39) missense probably damaging 1.00
R6763:Ptpro UTSW 6 137,395,279 (GRCm39) splice site probably null
R6888:Ptpro UTSW 6 137,357,198 (GRCm39) missense probably benign 0.30
R6983:Ptpro UTSW 6 137,426,915 (GRCm39) missense probably damaging 1.00
R7019:Ptpro UTSW 6 137,357,476 (GRCm39) missense probably benign
R7218:Ptpro UTSW 6 137,431,596 (GRCm39) missense probably damaging 1.00
R7236:Ptpro UTSW 6 137,345,335 (GRCm39) missense probably damaging 1.00
R7299:Ptpro UTSW 6 137,418,142 (GRCm39) critical splice donor site probably null
R7381:Ptpro UTSW 6 137,376,559 (GRCm39) missense possibly damaging 0.93
R7493:Ptpro UTSW 6 137,359,647 (GRCm39) missense probably benign 0.01
R7733:Ptpro UTSW 6 137,391,284 (GRCm39) nonsense probably null
R7793:Ptpro UTSW 6 137,393,818 (GRCm39) missense probably damaging 0.99
R7804:Ptpro UTSW 6 137,376,599 (GRCm39) splice site probably null
R7833:Ptpro UTSW 6 137,393,861 (GRCm39) nonsense probably null
R7859:Ptpro UTSW 6 137,369,805 (GRCm39) critical splice donor site probably null
R7873:Ptpro UTSW 6 137,407,737 (GRCm39) missense probably benign 0.44
R8042:Ptpro UTSW 6 137,393,881 (GRCm39) missense possibly damaging 0.71
R8859:Ptpro UTSW 6 137,403,782 (GRCm39) nonsense probably null
R8979:Ptpro UTSW 6 137,345,140 (GRCm39) missense probably benign
R9138:Ptpro UTSW 6 137,388,113 (GRCm39) critical splice donor site probably null
R9309:Ptpro UTSW 6 137,431,656 (GRCm39) missense probably damaging 1.00
R9420:Ptpro UTSW 6 137,420,933 (GRCm39) missense probably benign 0.08
R9612:Ptpro UTSW 6 137,391,318 (GRCm39) missense probably benign 0.31
R9697:Ptpro UTSW 6 137,363,288 (GRCm39) missense probably damaging 1.00
R9715:Ptpro UTSW 6 137,345,108 (GRCm39) missense probably damaging 0.96
Z1177:Ptpro UTSW 6 137,355,138 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTATATCTTTGGAAATGGCG -3'
(R):5'- TTAAATGCGAGACAGCGGAACC -3'

Sequencing Primer
(F):5'- CGAAGCAATAACCCATATTTACTCTG -3'
(R):5'- ACCAGGGGTGTATCTTCCATGAAG -3'
Posted On 2022-09-12