Incidental Mutation 'R0763:Itgax'
ID72509
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Nameintegrin alpha X
SynonymsCd11c, CD11C (p150) alpha polypeptide
MMRRC Submission 038943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R0763 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location128129547-128150657 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 128147940 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053]
Predicted Effect probably benign
Transcript: ENSMUST00000033053
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206396
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,838,279 F290V probably damaging Het
Adam26b G A 8: 43,520,564 S467L probably damaging Het
Adgrv1 T A 13: 81,499,125 I3099F probably damaging Het
Akap6 A G 12: 53,142,214 D2137G possibly damaging Het
Arhgdig T C 17: 26,200,301 Y48C probably damaging Het
Astn1 A G 1: 158,509,890 I389V possibly damaging Het
Atp8a1 T C 5: 67,659,883 D920G probably benign Het
BC016579 T A 16: 45,629,455 N200I probably damaging Het
Casc3 T C 11: 98,831,318 Y661H probably damaging Het
Cep120 A C 18: 53,721,737 V442G probably benign Het
Cfap65 A G 1: 74,904,682 Y1557H probably damaging Het
Chd2 G T 7: 73,447,274 Q1485K possibly damaging Het
Cntrl T C 2: 35,171,066 F1967L probably benign Het
Csmd1 G A 8: 17,027,284 T119M possibly damaging Het
Dnah9 T C 11: 66,155,530 H64R probably benign Het
Ep400 T C 5: 110,665,837 R2899G probably damaging Het
Fam205a1 A G 4: 42,851,238 V306A probably damaging Het
Foxl2 A C 9: 98,956,033 T125P probably damaging Het
Foxred1 A T 9: 35,207,473 probably null Het
H2-Eb1 T A 17: 34,314,159 probably benign Het
Heatr3 T C 8: 88,158,241 S378P probably damaging Het
Hectd4 T C 5: 121,307,033 probably benign Het
Hps3 T G 3: 20,003,279 R780S probably damaging Het
Ifi44 G A 3: 151,749,498 A30V probably damaging Het
Il12rb1 G A 8: 70,813,290 probably benign Het
Invs G A 4: 48,392,628 G281R possibly damaging Het
Jade1 G T 3: 41,613,783 C762F possibly damaging Het
Lama1 C T 17: 67,772,818 P1229S probably damaging Het
Mmp15 C A 8: 95,368,228 D243E probably benign Het
Mug2 A G 6: 122,075,294 T1004A probably benign Het
Myh14 A T 7: 44,665,367 V44E probably damaging Het
N4bp2l1 C A 5: 150,594,404 R11S possibly damaging Het
Notch4 T A 17: 34,565,332 C36* probably null Het
Nwd1 A G 8: 72,671,044 D637G probably damaging Het
Ogfod1 T C 8: 94,055,636 I238T probably benign Het
Palm2 G A 4: 57,688,441 E95K probably damaging Het
Papln A G 12: 83,791,865 D1256G possibly damaging Het
Ppp1r26 T C 2: 28,450,367 L3P probably damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc17a5 A T 9: 78,553,090 probably benign Het
Slc25a17 A G 15: 81,323,706 probably benign Het
Socs4 T C 14: 47,290,655 F349S probably damaging Het
Tchhl1 A C 3: 93,471,571 E527D probably benign Het
Tm7sf3 A G 6: 146,606,289 L425S possibly damaging Het
Tmem266 G T 9: 55,414,955 V112L probably damaging Het
Tmem30c T A 16: 57,270,176 I223F possibly damaging Het
Tomm70a G A 16: 57,122,172 G104D probably benign Het
Ttc17 G T 2: 94,332,803 A834E probably benign Het
Ttn C T 2: 76,731,190 V20664M probably damaging Het
Zbed5 T C 5: 129,902,179 V323A probably benign Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 128135326 missense probably damaging 1.00
IGL00325:Itgax APN 7 128148309 missense possibly damaging 0.69
IGL01155:Itgax APN 7 128145035 missense probably benign 0.00
IGL01461:Itgax APN 7 128135018 missense probably damaging 1.00
IGL01508:Itgax APN 7 128144818 missense probably damaging 1.00
IGL01549:Itgax APN 7 128131206 splice site probably null
IGL01864:Itgax APN 7 128133763 missense probably benign 0.00
IGL02094:Itgax APN 7 128131473 missense probably damaging 1.00
IGL02364:Itgax APN 7 128139982 missense possibly damaging 0.89
IGL02969:Itgax APN 7 128149123 missense probably benign
IGL03406:Itgax APN 7 128149198 missense possibly damaging 0.93
Adendritic UTSW 7 128148572 nonsense probably null
PIT4651001:Itgax UTSW 7 128149110 missense probably benign 0.11
R0366:Itgax UTSW 7 128149089 splice site probably benign
R1072:Itgax UTSW 7 128150144 missense probably damaging 0.96
R1659:Itgax UTSW 7 128130891 missense probably benign 0.15
R2019:Itgax UTSW 7 128148526 missense probably benign
R2418:Itgax UTSW 7 128142333 missense probably damaging 0.98
R3027:Itgax UTSW 7 128148572 nonsense probably null
R3846:Itgax UTSW 7 128133767 missense probably damaging 1.00
R3938:Itgax UTSW 7 128136273 missense possibly damaging 0.73
R4021:Itgax UTSW 7 128133139 critical splice donor site probably null
R4027:Itgax UTSW 7 128141266 missense possibly damaging 0.75
R4163:Itgax UTSW 7 128144700 missense probably benign 0.00
R4923:Itgax UTSW 7 128148528 missense probably benign
R5259:Itgax UTSW 7 128148278 missense probably damaging 0.99
R5333:Itgax UTSW 7 128142283 missense probably damaging 1.00
R5347:Itgax UTSW 7 128141302 missense probably benign 0.08
R5679:Itgax UTSW 7 128134990 missense probably benign 0.00
R5725:Itgax UTSW 7 128147861 missense possibly damaging 0.63
R5733:Itgax UTSW 7 128140475 missense probably damaging 0.99
R5750:Itgax UTSW 7 128144706 missense probably benign 0.32
R5964:Itgax UTSW 7 128140447 missense probably damaging 1.00
R6004:Itgax UTSW 7 128131452 missense probably damaging 0.96
R6168:Itgax UTSW 7 128133097 missense probably damaging 0.99
R6212:Itgax UTSW 7 128130332 missense possibly damaging 0.52
R6212:Itgax UTSW 7 128147853 missense probably benign 0.16
R6480:Itgax UTSW 7 128148599 missense probably benign 0.12
R6484:Itgax UTSW 7 128133718 missense probably benign 0.13
R6796:Itgax UTSW 7 128135064 missense probably damaging 1.00
R6844:Itgax UTSW 7 128147934 splice site probably null
R7287:Itgax UTSW 7 128148505 missense probably damaging 1.00
R7365:Itgax UTSW 7 128135309 missense probably damaging 1.00
R7421:Itgax UTSW 7 128140432 missense probably damaging 1.00
X0061:Itgax UTSW 7 128129607 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AACCTCATTCCATGCTGTCCCAAG -3'
(R):5'- CAAGGGTGTCAGTTAAGGAGCCAC -3'

Sequencing Primer
(F):5'- CATGCTGTCCCAAGTCCAG -3'
(R):5'- CCGGTAGTCGTATACCTGAGG -3'
Posted On2013-09-30