Mutagenetix > Incidental Mutation

Incidental Mutation 'R9625:Myo1d'

725103

Institutional Source

Beutler Lab

Gene Symbol

Myo1d

Ensembl Gene

ENSMUSG00000035441

Gene Name

myosin ID

Synonyms

9930104H07Rik, D11Ertd9e

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9625 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80482126-80780025 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 80557470 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Valine at position 943 (G943V)

Ref Sequence

ENSEMBL: ENSMUSP00000037819 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041065]

AlphaFold

Q5SYD0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041065
AA Change: G943V

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: G943V

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	803	1006	4.1e-49	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432M17Rik	A	G	3: 121,671,384	E23G	unknown	Het
Abhd5	A	G	9: 122,379,541	Y332C	probably damaging	Het
Adcyap1r1	A	T	6: 55,480,070	E262V	probably damaging	Het
Adgre5	A	G	8: 83,724,029	Y793H	probably damaging	Het
Arhgef33	A	T	17: 80,347,278	Y78F	possibly damaging	Het
Asl	G	A	5: 130,018,852	A91V	probably damaging	Het
Cd40	A	T	2: 165,063,141	I126F	probably benign	Het
Ceacam10	A	G	7: 24,777,280	E2G	probably damaging	Het
Cfap46	C	T	7: 139,650,889	R941H		Het
Cntnap3	A	T	13: 64,858,765	S78T	probably damaging	Het
Cntnap4	T	C	8: 112,875,549	V1195A	possibly damaging	Het
Cthrc1	T	C	15: 39,084,479	S198P	probably damaging	Het
Dcaf7	T	G	11: 106,051,968		probably null	Het
Dhx16	A	G	17: 35,882,521	E252G	probably benign	Het
Efcab2	C	T	1: 178,474,940	T83I	possibly damaging	Het
Efhc1	A	G	1: 20,979,514	N533D	probably benign	Het
Emilin2	A	G	17: 71,274,117	V538A	probably benign	Het
Fam171b	A	T	2: 83,853,570	T144S	probably damaging	Het
Fam98a	A	G	17: 75,538,479	F424S	unknown	Het
Gm3573	T	C	14: 42,189,648	R42G	possibly damaging	Het
Gpr143	GTTTTTT	GTTTTTTT	X: 152,795,631		probably null	Het
H2-K1	G	A	17: 34,000,001	P23S	probably benign	Het
Hormad2	G	A	11: 4,427,372	P22L	probably damaging	Het
Hoxb1	C	T	11: 96,365,984	A53V	probably benign	Het
Kalrn	T	A	16: 34,028,827		probably null	Het
Kdm2a	C	T	19: 4,343,113	D405N		Het
Kif1a	C	T	1: 93,073,044	E287K	probably benign	Het
Lrrk1	A	T	7: 66,259,918	*2015K	probably null	Het
Ltbp1	G	T	17: 75,179,162	G61C	probably damaging	Het
Mthfd2l	A	G	5: 90,959,708	H143R	probably damaging	Het
Ncoa1	T	A	12: 4,295,643	Q568L	probably damaging	Het
Ncoa3	G	A	2: 166,057,210	S824N	probably benign	Het
Nfe2l3	A	T	6: 51,457,945	D495V	probably damaging	Het
Nicn1	C	T	9: 108,294,509	R163C	possibly damaging	Het
Nlrp14	A	G	7: 107,182,962	I455M	probably benign	Het
Npb	T	C	11: 120,608,549	L14P	probably damaging	Het
Olfr566	C	T	7: 102,856,429	M284I	probably benign	Het
P2ry12	G	A	3: 59,218,075	R60C	possibly damaging	Het
Pcdhb17	T	A	18: 37,486,366	L403*	probably null	Het
Phb2	G	A	6: 124,714,011	R44H	probably damaging	Het
Plekha5	A	T	6: 140,426,527	T68S	probably benign	Het
Ptprg	C	T	14: 12,152,027	R447W	probably damaging	Het
Ptprk	T	C	10: 28,586,010	Y1190H	probably damaging	Het
Ptpro	G	T	6: 137,394,875	C630F	probably damaging	Het
Rrp15	G	T	1: 186,721,521	P243Q	possibly damaging	Het
Smurf1	A	G	5: 144,894,110	F285S	possibly damaging	Het
Spata13	C	T	14: 60,706,900	P581S	probably benign	Het
Tex44	T	C	1: 86,426,531	I54T	unknown	Het
Tom1l2	A	G	11: 60,270,451	V78A	probably damaging	Het
Vps11	A	G	9: 44,354,441	W514R	probably damaging	Het
Wnk2	C	A	13: 49,100,969	V357L	probably benign	Het
Zfp970	C	T	2: 177,475,997	Q455*	probably null	Het

Other mutations in Myo1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Myo1d	APN	11	80601740	missense	probably benign
IGL01087:Myo1d	APN	11	80682435	missense	probably damaging	1.00
IGL01326:Myo1d	APN	11	80684321	splice site	probably benign
IGL01431:Myo1d	APN	11	80674839	missense	probably damaging	1.00
IGL01595:Myo1d	APN	11	80676110	missense	probably benign	0.00
IGL01811:Myo1d	APN	11	80692997	missense	probably damaging	0.96
IGL02301:Myo1d	APN	11	80676853	missense	probably benign	0.23
IGL02388:Myo1d	APN	11	80637997	nonsense	probably null
IGL02485:Myo1d	APN	11	80666581	missense	probably damaging	1.00
IGL03017:Myo1d	APN	11	80601626	missense	probably benign	0.26
horton	UTSW	11	80674708	missense	probably damaging	1.00
multifaceted	UTSW	11	80693072	missense	probably damaging	1.00
whisper	UTSW	11	80484332	missense	probably damaging	0.99
whisper2	UTSW	11	80666578	missense	probably damaging	1.00
whisper3	UTSW	11	80557521	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0081:Myo1d	UTSW	11	80557523	missense	probably benign	0.00
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0244:Myo1d	UTSW	11	80674708	missense	probably damaging	1.00
R0711:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0746:Myo1d	UTSW	11	80586879	missense	possibly damaging	0.94
R1084:Myo1d	UTSW	11	80684395	missense	probably damaging	1.00
R1514:Myo1d	UTSW	11	80685908	missense	probably damaging	0.97
R1676:Myo1d	UTSW	11	80684421	missense	probably damaging	1.00
R1862:Myo1d	UTSW	11	80663048	missense	probably damaging	1.00
R2497:Myo1d	UTSW	11	80674821	missense	probably damaging	1.00
R2512:Myo1d	UTSW	11	80779717	missense	probably benign	0.00
R3425:Myo1d	UTSW	11	80601638	missense	probably benign
R3429:Myo1d	UTSW	11	80682410	missense	probably damaging	1.00
R3917:Myo1d	UTSW	11	80666578	missense	probably damaging	1.00
R3928:Myo1d	UTSW	11	80484261	missense	probably benign	0.09
R4706:Myo1d	UTSW	11	80666641	missense	probably damaging	0.96
R4723:Myo1d	UTSW	11	80779841	utr 5 prime	probably benign
R4924:Myo1d	UTSW	11	80674678	missense	probably damaging	1.00
R5042:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R5320:Myo1d	UTSW	11	80684323	critical splice donor site	probably null
R5481:Myo1d	UTSW	11	80663095	missense	possibly damaging	0.79
R6214:Myo1d	UTSW	11	80779791	start codon destroyed	probably null	0.98
R6235:Myo1d	UTSW	11	80692944	missense	probably benign	0.23
R6282:Myo1d	UTSW	11	80557512	missense	probably damaging	0.99
R6468:Myo1d	UTSW	11	80557474	missense	probably benign	0.00
R6668:Myo1d	UTSW	11	80583875	intron	probably benign
R6954:Myo1d	UTSW	11	80674957	missense	probably benign	0.21
R7077:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7078:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7080:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7172:Myo1d	UTSW	11	80592795	missense	probably benign	0.16
R7276:Myo1d	UTSW	11	80693072	missense	probably damaging	1.00
R7467:Myo1d	UTSW	11	80586917	missense	probably damaging	1.00
R7650:Myo1d	UTSW	11	80601684	missense	probably benign
R7678:Myo1d	UTSW	11	80676893	missense	possibly damaging	0.80
R7859:Myo1d	UTSW	11	80684377	missense	probably damaging	1.00
R8324:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R8329:Myo1d	UTSW	11	80638074	missense	probably benign	0.21
R8474:Myo1d	UTSW	11	80670919	missense	possibly damaging	0.93
R8799:Myo1d	UTSW	11	80684379	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80674932	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80676932	missense	probably benign	0.30
R8823:Myo1d	UTSW	11	80601745	missense	possibly damaging	0.91
R9221:Myo1d	UTSW	11	80674918	missense	probably damaging	1.00
R9494:Myo1d	UTSW	11	80484267	missense	probably benign	0.02
R9626:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9628:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
Z1088:Myo1d	UTSW	11	80674898	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATAAGGCCGGATGCTAATTTCAC -3'
(R):5'- TCACCATCGTTGCTATGGC -3'

Sequencing Primer
(F):5'- GCCGGATGCTAATTTCACCTTCTATG -3'
(R):5'- ATCGTTGCTATGGCCTGCTC -3'

Posted On

2022-09-12