Incidental Mutation 'R0763:Adam26b'
ID72511
Institutional Source Beutler Lab
Gene Symbol Adam26b
Ensembl Gene ENSMUSG00000063900
Gene Namea disintegrin and metallopeptidase domain 26B
Synonyms
MMRRC Submission 038943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0763 (G1)
Quality Score212
Status Validated
Chromosome8
Chromosomal Location43519762-43528106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43520564 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 467 (S467L)
Ref Sequence ENSEMBL: ENSMUSP00000079032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080135]
Predicted Effect probably damaging
Transcript: ENSMUST00000080135
AA Change: S467L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079032
Gene: ENSMUSG00000063900
AA Change: S467L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 147 4.9e-18 PFAM
Pfam:Reprolysin_5 193 364 4.8e-15 PFAM
Pfam:Reprolysin_4 194 380 1.3e-8 PFAM
Pfam:Reprolysin 195 385 9.9e-50 PFAM
Pfam:Reprolysin_2 215 377 3.9e-15 PFAM
Pfam:Reprolysin_3 219 340 2e-15 PFAM
DISIN 401 476 5.88e-40 SMART
ACR 477 613 7.69e-64 SMART
low complexity region 631 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,838,279 F290V probably damaging Het
Adgrv1 T A 13: 81,499,125 I3099F probably damaging Het
Akap6 A G 12: 53,142,214 D2137G possibly damaging Het
Arhgdig T C 17: 26,200,301 Y48C probably damaging Het
Astn1 A G 1: 158,509,890 I389V possibly damaging Het
Atp8a1 T C 5: 67,659,883 D920G probably benign Het
BC016579 T A 16: 45,629,455 N200I probably damaging Het
Casc3 T C 11: 98,831,318 Y661H probably damaging Het
Cep120 A C 18: 53,721,737 V442G probably benign Het
Cfap65 A G 1: 74,904,682 Y1557H probably damaging Het
Chd2 G T 7: 73,447,274 Q1485K possibly damaging Het
Cntrl T C 2: 35,171,066 F1967L probably benign Het
Csmd1 G A 8: 17,027,284 T119M possibly damaging Het
Dnah9 T C 11: 66,155,530 H64R probably benign Het
Ep400 T C 5: 110,665,837 R2899G probably damaging Het
Fam205a1 A G 4: 42,851,238 V306A probably damaging Het
Foxl2 A C 9: 98,956,033 T125P probably damaging Het
Foxred1 A T 9: 35,207,473 probably null Het
H2-Eb1 T A 17: 34,314,159 probably benign Het
Heatr3 T C 8: 88,158,241 S378P probably damaging Het
Hectd4 T C 5: 121,307,033 probably benign Het
Hps3 T G 3: 20,003,279 R780S probably damaging Het
Ifi44 G A 3: 151,749,498 A30V probably damaging Het
Il12rb1 G A 8: 70,813,290 probably benign Het
Invs G A 4: 48,392,628 G281R possibly damaging Het
Itgax C A 7: 128,147,940 probably benign Het
Jade1 G T 3: 41,613,783 C762F possibly damaging Het
Lama1 C T 17: 67,772,818 P1229S probably damaging Het
Mmp15 C A 8: 95,368,228 D243E probably benign Het
Mug2 A G 6: 122,075,294 T1004A probably benign Het
Myh14 A T 7: 44,665,367 V44E probably damaging Het
N4bp2l1 C A 5: 150,594,404 R11S possibly damaging Het
Notch4 T A 17: 34,565,332 C36* probably null Het
Nwd1 A G 8: 72,671,044 D637G probably damaging Het
Ogfod1 T C 8: 94,055,636 I238T probably benign Het
Palm2 G A 4: 57,688,441 E95K probably damaging Het
Papln A G 12: 83,791,865 D1256G possibly damaging Het
Ppp1r26 T C 2: 28,450,367 L3P probably damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc17a5 A T 9: 78,553,090 probably benign Het
Slc25a17 A G 15: 81,323,706 probably benign Het
Socs4 T C 14: 47,290,655 F349S probably damaging Het
Tchhl1 A C 3: 93,471,571 E527D probably benign Het
Tm7sf3 A G 6: 146,606,289 L425S possibly damaging Het
Tmem266 G T 9: 55,414,955 V112L probably damaging Het
Tmem30c T A 16: 57,270,176 I223F possibly damaging Het
Tomm70a G A 16: 57,122,172 G104D probably benign Het
Ttc17 G T 2: 94,332,803 A834E probably benign Het
Ttn C T 2: 76,731,190 V20664M probably damaging Het
Zbed5 T C 5: 129,902,179 V323A probably benign Het
Other mutations in Adam26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Adam26b APN 8 43520179 missense probably damaging 1.00
IGL00806:Adam26b APN 8 43521342 missense probably damaging 1.00
IGL00984:Adam26b APN 8 43520373 missense possibly damaging 0.86
IGL01081:Adam26b APN 8 43519938 missense probably benign 0.00
IGL01783:Adam26b APN 8 43521761 missense probably benign 0.30
IGL02021:Adam26b APN 8 43519872 missense probably benign
IGL02707:Adam26b APN 8 43519858 utr 3 prime probably benign
IGL03112:Adam26b APN 8 43521512 missense probably benign
R0195:Adam26b UTSW 8 43520270 missense probably damaging 0.99
R0453:Adam26b UTSW 8 43520350 missense probably benign 0.00
R0562:Adam26b UTSW 8 43520371 missense probably benign 0.36
R0645:Adam26b UTSW 8 43520487 missense probably damaging 1.00
R1697:Adam26b UTSW 8 43520963 missense probably damaging 0.98
R1739:Adam26b UTSW 8 43521677 missense probably damaging 1.00
R1751:Adam26b UTSW 8 43519911 missense probably benign 0.00
R1767:Adam26b UTSW 8 43519911 missense probably benign 0.00
R1994:Adam26b UTSW 8 43520639 missense probably benign 0.44
R3747:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3748:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3750:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3771:Adam26b UTSW 8 43520714 missense probably damaging 1.00
R4027:Adam26b UTSW 8 43520372 missense probably benign 0.09
R4652:Adam26b UTSW 8 43521338 missense possibly damaging 0.49
R4790:Adam26b UTSW 8 43520727 missense probably benign 0.19
R4859:Adam26b UTSW 8 43520259 missense possibly damaging 0.80
R5059:Adam26b UTSW 8 43520600 missense probably damaging 1.00
R5191:Adam26b UTSW 8 43519991 missense probably damaging 1.00
R5540:Adam26b UTSW 8 43521617 missense probably damaging 1.00
R5568:Adam26b UTSW 8 43520492 missense probably benign 0.00
R5886:Adam26b UTSW 8 43520273 missense possibly damaging 0.72
R5935:Adam26b UTSW 8 43521298 missense probably benign 0.00
R5983:Adam26b UTSW 8 43521341 missense probably damaging 1.00
R6544:Adam26b UTSW 8 43521781 missense probably damaging 0.98
R6610:Adam26b UTSW 8 43521153 missense probably damaging 1.00
R6668:Adam26b UTSW 8 43520690 missense possibly damaging 0.72
R6966:Adam26b UTSW 8 43521435 missense possibly damaging 0.51
R7545:Adam26b UTSW 8 43521713 missense probably damaging 0.98
R7596:Adam26b UTSW 8 43520200 missense probably benign
R7634:Adam26b UTSW 8 43520997 missense probably benign
R7657:Adam26b UTSW 8 43521542 missense possibly damaging 0.95
R7692:Adam26b UTSW 8 43520795 missense probably benign 0.00
R7769:Adam26b UTSW 8 43521695 missense probably benign 0.00
R7912:Adam26b UTSW 8 43520208 missense probably benign 0.13
R7993:Adam26b UTSW 8 43520208 missense probably benign 0.13
X0066:Adam26b UTSW 8 43520004 missense probably damaging 0.97
Z1088:Adam26b UTSW 8 43520597 missense probably damaging 0.99
Z1177:Adam26b UTSW 8 43520698 missense probably benign 0.24
Z1177:Adam26b UTSW 8 43521422 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATTGCCACAGTTCCCAAAGCG -3'
(R):5'- CATGGCACACATTGTAGCACATGAG -3'

Sequencing Primer
(F):5'- AGTTCCCAAAGCGGTCAC -3'
(R):5'- GGTTAAAAGACTGTCTAATGGCCC -3'
Posted On2013-09-30