Incidental Mutation 'R9625:Gm3573'
ID 725111
Institutional Source Beutler Lab
Gene Symbol Gm3573
Ensembl Gene ENSMUSG00000091792
Gene Name predicted gene 3573
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock # R9625 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 42185391-42190791 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42189648 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 42 (R42G)
Ref Sequence ENSEMBL: ENSMUSP00000127488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168673]
AlphaFold L7N292
Predicted Effect possibly damaging
Transcript: ENSMUST00000168673
AA Change: R42G

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127488
Gene: ENSMUSG00000091792
AA Change: R42G

DomainStartEndE-ValueType
Pfam:Takusan 10 88 1.4e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A G 3: 121,671,384 E23G unknown Het
Abhd5 A G 9: 122,379,541 Y332C probably damaging Het
Adcyap1r1 A T 6: 55,480,070 E262V probably damaging Het
Adgre5 A G 8: 83,724,029 Y793H probably damaging Het
Arhgef33 A T 17: 80,347,278 Y78F possibly damaging Het
Asl G A 5: 130,018,852 A91V probably damaging Het
Cd40 A T 2: 165,063,141 I126F probably benign Het
Ceacam10 A G 7: 24,777,280 E2G probably damaging Het
Cfap46 C T 7: 139,650,889 R941H Het
Cntnap3 A T 13: 64,858,765 S78T probably damaging Het
Cntnap4 T C 8: 112,875,549 V1195A possibly damaging Het
Cthrc1 T C 15: 39,084,479 S198P probably damaging Het
Dcaf7 T G 11: 106,051,968 probably null Het
Dhx16 A G 17: 35,882,521 E252G probably benign Het
Efcab2 C T 1: 178,474,940 T83I possibly damaging Het
Efhc1 A G 1: 20,979,514 N533D probably benign Het
Emilin2 A G 17: 71,274,117 V538A probably benign Het
Fam171b A T 2: 83,853,570 T144S probably damaging Het
Fam98a A G 17: 75,538,479 F424S unknown Het
Gpr143 GTTTTTT GTTTTTTT X: 152,795,631 probably null Het
H2-K1 G A 17: 34,000,001 P23S probably benign Het
Hormad2 G A 11: 4,427,372 P22L probably damaging Het
Hoxb1 C T 11: 96,365,984 A53V probably benign Het
Kalrn T A 16: 34,028,827 probably null Het
Kdm2a C T 19: 4,343,113 D405N Het
Kif1a C T 1: 93,073,044 E287K probably benign Het
Lrrk1 A T 7: 66,259,918 *2015K probably null Het
Ltbp1 G T 17: 75,179,162 G61C probably damaging Het
Mthfd2l A G 5: 90,959,708 H143R probably damaging Het
Myo1d C A 11: 80,557,470 G943V possibly damaging Het
Ncoa1 T A 12: 4,295,643 Q568L probably damaging Het
Ncoa3 G A 2: 166,057,210 S824N probably benign Het
Nfe2l3 A T 6: 51,457,945 D495V probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nlrp14 A G 7: 107,182,962 I455M probably benign Het
Npb T C 11: 120,608,549 L14P probably damaging Het
Olfr566 C T 7: 102,856,429 M284I probably benign Het
P2ry12 G A 3: 59,218,075 R60C possibly damaging Het
Pcdhb17 T A 18: 37,486,366 L403* probably null Het
Phb2 G A 6: 124,714,011 R44H probably damaging Het
Plekha5 A T 6: 140,426,527 T68S probably benign Het
Ptprg C T 14: 12,152,027 R447W probably damaging Het
Ptprk T C 10: 28,586,010 Y1190H probably damaging Het
Ptpro G T 6: 137,394,875 C630F probably damaging Het
Rrp15 G T 1: 186,721,521 P243Q possibly damaging Het
Smurf1 A G 5: 144,894,110 F285S possibly damaging Het
Spata13 C T 14: 60,706,900 P581S probably benign Het
Tex44 T C 1: 86,426,531 I54T unknown Het
Tom1l2 A G 11: 60,270,451 V78A probably damaging Het
Vps11 A G 9: 44,354,441 W514R probably damaging Het
Wnk2 C A 13: 49,100,969 V357L probably benign Het
Zfp970 C T 2: 177,475,997 Q455* probably null Het
Other mutations in Gm3573
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Gm3573 APN 14 42187566 missense probably benign 0.08
IGL02548:Gm3573 APN 14 42187495 critical splice donor site probably null
R6774:Gm3573 UTSW 14 42187515 missense possibly damaging 0.86
R6827:Gm3573 UTSW 14 42188472 missense probably benign 0.00
R7607:Gm3573 UTSW 14 42189750 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CCAATCAGGCAGAAGAGTTTGG -3'
(R):5'- GCTCTTTCAGGGATTCACAGTG -3'

Sequencing Primer
(F):5'- AGAGTTTGGATATGTGGACAGCC -3'
(R):5'- CAGGGATTCACAGTGTCTCTAG -3'
Posted On 2022-09-12