Incidental Mutation 'R0763:Heatr3'
ID72514
Institutional Source Beutler Lab
Gene Symbol Heatr3
Ensembl Gene ENSMUSG00000031657
Gene NameHEAT repeat containing 3
SynonymsC030036P15Rik
MMRRC Submission 038943-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R0763 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location88137855-88172027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88158241 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 378 (S378P)
Ref Sequence ENSEMBL: ENSMUSP00000112812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034079] [ENSMUST00000121949]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034079
AA Change: S495P

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034079
Gene: ENSMUSG00000031657
AA Change: S495P

DomainStartEndE-ValueType
Pfam:HEAT_EZ 41 106 2.5e-11 PFAM
Blast:ARM 111 171 2e-25 BLAST
Blast:ARM 172 215 1e-15 BLAST
low complexity region 357 366 N/A INTRINSIC
low complexity region 375 393 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121949
AA Change: S378P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112812
Gene: ENSMUSG00000031657
AA Change: S378P

DomainStartEndE-ValueType
Blast:ARM 1 54 7e-20 BLAST
Blast:ARM 55 98 8e-16 BLAST
low complexity region 240 249 N/A INTRINSIC
low complexity region 258 276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146946
Meta Mutation Damage Score 0.1926 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in ribosomal protein transport and in the assembly of the 5S ribonucleoprotein particle (5S RNP). The encoded protein also may be involved in NOD2-mediated NF-kappaB signaling. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,838,279 F290V probably damaging Het
Adam26b G A 8: 43,520,564 S467L probably damaging Het
Adgrv1 T A 13: 81,499,125 I3099F probably damaging Het
Akap6 A G 12: 53,142,214 D2137G possibly damaging Het
Arhgdig T C 17: 26,200,301 Y48C probably damaging Het
Astn1 A G 1: 158,509,890 I389V possibly damaging Het
Atp8a1 T C 5: 67,659,883 D920G probably benign Het
BC016579 T A 16: 45,629,455 N200I probably damaging Het
Casc3 T C 11: 98,831,318 Y661H probably damaging Het
Cep120 A C 18: 53,721,737 V442G probably benign Het
Cfap65 A G 1: 74,904,682 Y1557H probably damaging Het
Chd2 G T 7: 73,447,274 Q1485K possibly damaging Het
Cntrl T C 2: 35,171,066 F1967L probably benign Het
Csmd1 G A 8: 17,027,284 T119M possibly damaging Het
Dnah9 T C 11: 66,155,530 H64R probably benign Het
Ep400 T C 5: 110,665,837 R2899G probably damaging Het
Fam205a1 A G 4: 42,851,238 V306A probably damaging Het
Foxl2 A C 9: 98,956,033 T125P probably damaging Het
Foxred1 A T 9: 35,207,473 probably null Het
H2-Eb1 T A 17: 34,314,159 probably benign Het
Hectd4 T C 5: 121,307,033 probably benign Het
Hps3 T G 3: 20,003,279 R780S probably damaging Het
Ifi44 G A 3: 151,749,498 A30V probably damaging Het
Il12rb1 G A 8: 70,813,290 probably benign Het
Invs G A 4: 48,392,628 G281R possibly damaging Het
Itgax C A 7: 128,147,940 probably benign Het
Jade1 G T 3: 41,613,783 C762F possibly damaging Het
Lama1 C T 17: 67,772,818 P1229S probably damaging Het
Mmp15 C A 8: 95,368,228 D243E probably benign Het
Mug2 A G 6: 122,075,294 T1004A probably benign Het
Myh14 A T 7: 44,665,367 V44E probably damaging Het
N4bp2l1 C A 5: 150,594,404 R11S possibly damaging Het
Notch4 T A 17: 34,565,332 C36* probably null Het
Nwd1 A G 8: 72,671,044 D637G probably damaging Het
Ogfod1 T C 8: 94,055,636 I238T probably benign Het
Palm2 G A 4: 57,688,441 E95K probably damaging Het
Papln A G 12: 83,791,865 D1256G possibly damaging Het
Ppp1r26 T C 2: 28,450,367 L3P probably damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc17a5 A T 9: 78,553,090 probably benign Het
Slc25a17 A G 15: 81,323,706 probably benign Het
Socs4 T C 14: 47,290,655 F349S probably damaging Het
Tchhl1 A C 3: 93,471,571 E527D probably benign Het
Tm7sf3 A G 6: 146,606,289 L425S possibly damaging Het
Tmem266 G T 9: 55,414,955 V112L probably damaging Het
Tmem30c T A 16: 57,270,176 I223F possibly damaging Het
Tomm70a G A 16: 57,122,172 G104D probably benign Het
Ttc17 G T 2: 94,332,803 A834E probably benign Het
Ttn C T 2: 76,731,190 V20664M probably damaging Het
Zbed5 T C 5: 129,902,179 V323A probably benign Het
Other mutations in Heatr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Heatr3 APN 8 88141739 missense possibly damaging 0.95
IGL00780:Heatr3 APN 8 88170940 missense probably benign 0.01
IGL01105:Heatr3 APN 8 88161893 missense probably benign 0.04
IGL01653:Heatr3 APN 8 88144617 missense probably benign
IGL02129:Heatr3 APN 8 88158271 splice site probably benign
IGL02145:Heatr3 APN 8 88144599 missense probably benign 0.40
IGL02177:Heatr3 APN 8 88156723 missense probably benign
IGL02309:Heatr3 APN 8 88167072 missense probably damaging 1.00
IGL02675:Heatr3 APN 8 88144557 missense possibly damaging 0.91
IGL03379:Heatr3 APN 8 88150110 missense probably benign 0.13
R1244:Heatr3 UTSW 8 88141739 missense possibly damaging 0.95
R1883:Heatr3 UTSW 8 88144593 missense possibly damaging 0.95
R1988:Heatr3 UTSW 8 88150317 missense probably benign 0.02
R2043:Heatr3 UTSW 8 88147694 splice site probably benign
R2079:Heatr3 UTSW 8 88141776 missense probably damaging 0.99
R2402:Heatr3 UTSW 8 88144572 missense probably benign 0.33
R3916:Heatr3 UTSW 8 88150371 critical splice donor site probably null
R3917:Heatr3 UTSW 8 88150371 critical splice donor site probably null
R4127:Heatr3 UTSW 8 88138311 missense probably damaging 0.99
R4182:Heatr3 UTSW 8 88171002 utr 3 prime probably benign
R4190:Heatr3 UTSW 8 88138260 unclassified probably benign
R4769:Heatr3 UTSW 8 88141783 critical splice donor site probably null
R6046:Heatr3 UTSW 8 88139954 missense probably damaging 1.00
R6073:Heatr3 UTSW 8 88138140 missense probably benign 0.01
R6888:Heatr3 UTSW 8 88170884 missense probably damaging 1.00
R7284:Heatr3 UTSW 8 88156774 missense possibly damaging 0.69
RF025:Heatr3 UTSW 8 88156456 critical splice acceptor site probably benign
RF031:Heatr3 UTSW 8 88156457 critical splice acceptor site probably benign
RF033:Heatr3 UTSW 8 88156456 critical splice acceptor site probably benign
RF040:Heatr3 UTSW 8 88156457 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- GCCATAGAGTGCCAGGATGTCAAC -3'
(R):5'- GCAATGACCAAACTGATCCAGAGGG -3'

Sequencing Primer
(F):5'- CCAGGATGTCAACGTTAGATTG -3'
(R):5'- GACACACCCTGACTGTCATTG -3'
Posted On2013-09-30