Incidental Mutation 'R9626:Adgrd1'
ID 725141
Institutional Source Beutler Lab
Gene Symbol Adgrd1
Ensembl Gene ENSMUSG00000044017
Gene Name adhesion G protein-coupled receptor D1
Synonyms E230012M21Rik, Gpr133
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9626 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 129096750-129204599 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 129198657 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 768 (S768P)
Ref Sequence ENSEMBL: ENSMUSP00000060307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056617] [ENSMUST00000156437]
AlphaFold Q80T32
Predicted Effect probably damaging
Transcript: ENSMUST00000056617
AA Change: S768P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060307
Gene: ENSMUSG00000044017
AA Change: S768P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Laminin_G_3 119 273 2.9e-18 PFAM
Pfam:Pentaxin 171 288 2.2e-7 PFAM
GPS 535 585 1.57e-14 SMART
Pfam:Dicty_CAR 590 856 1.2e-8 PFAM
Pfam:7tm_2 592 831 8e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156437
AA Change: S736P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121217
Gene: ENSMUSG00000044017
AA Change: S736P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The adhesion G-protein-coupled receptors (GPCRs), including GPR133, are membrane-bound proteins with long N termini containing multiple domains. GPCRs, or GPRs, contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins (summary by Bjarnadottir et al., 2004 [PubMed 15203201]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T A 6: 50,573,950 K506N Het
Aass T A 6: 23,127,503 N37I unknown Het
Abca9 T A 11: 110,120,780 T1146S probably benign Het
Acnat2 G A 4: 49,380,179 H400Y probably damaging Het
Arap2 T A 5: 62,749,535 H47L probably benign Het
Armc4 G T 18: 7,211,422 C817* probably null Het
Atxn1 T A 13: 45,557,320 N712I possibly damaging Het
Bri3bp T A 5: 125,454,508 S173T probably damaging Het
Camta1 A T 4: 151,083,830 S254R probably damaging Het
Card9 T C 2: 26,357,282 E285G probably benign Het
Celf2 G A 2: 6,586,024 A320V probably benign Het
Celsr3 T C 9: 108,849,322 I3250T probably damaging Het
Cfap46 C T 7: 139,650,889 R941H Het
Cntrob T C 11: 69,311,341 H475R possibly damaging Het
Dcaf6 G A 1: 165,399,695 R288* probably null Het
Ebna1bp2 G A 4: 118,621,174 probably benign Het
Erich3 A T 3: 154,739,093 D302V probably benign Het
Fbxo48 T A 11: 16,954,333 *162K probably null Het
Fyttd1 T C 16: 32,905,545 L290S probably damaging Het
Gcc1 T C 6: 28,418,918 D472G probably damaging Het
Gjb4 C T 4: 127,352,288 probably benign Het
Gm5157 G T 7: 21,185,471 T49K probably damaging Het
Gpr143 GTTTTTT GTTTTTTT X: 152,795,631 probably null Het
Hnrnpm G T 17: 33,677,290 D88E probably damaging Het
Hormad2 G A 11: 4,427,372 P22L probably damaging Het
Hunk C T 16: 90,475,903 T365M probably damaging Het
Lamb1 A G 12: 31,304,670 D972G probably benign Het
Mamdc4 A G 2: 25,568,261 L379P probably damaging Het
Mcrs1 A G 15: 99,248,472 L179P probably damaging Het
Mterf2 C T 10: 85,120,431 A110T probably benign Het
Mucl1 A G 15: 103,753,668 S91P possibly damaging Het
Myo1d C A 11: 80,557,470 G943V possibly damaging Het
Ndst4 A C 3: 125,683,180 D18A probably damaging Het
Ndufv1 A T 19: 4,008,064 C382* probably null Het
Npc1l1 T C 11: 6,227,854 K519E probably benign Het
Nphs1 A G 7: 30,467,566 K747E probably benign Het
Nubp2 C G 17: 24,884,400 probably null Het
Olfr1352 T G 10: 78,984,379 D196E probably benign Het
Olfr1447 A T 19: 12,901,236 D181E possibly damaging Het
Olfr19 A G 16: 16,673,627 M118T probably damaging Het
Olfr525 T C 7: 140,323,323 V208A probably benign Het
Olfr912 A G 9: 38,581,681 T135A probably benign Het
Pcdhac2 T G 18: 37,146,502 L845R probably damaging Het
Pcdhb14 A C 18: 37,448,734 T298P probably damaging Het
Phldb2 A T 16: 45,772,184 L957Q possibly damaging Het
Pole A G 5: 110,312,093 D1121G possibly damaging Het
Ppp1r3g C A 13: 35,969,629 T344K probably benign Het
Prpf8 A G 11: 75,494,855 K954R possibly damaging Het
Prr15l C A 11: 96,934,614 Y23* probably null Het
Sap18b A G 8: 95,825,470 E36G possibly damaging Het
Slc46a2 A T 4: 59,914,241 F227L probably benign Het
Spata13 C T 14: 60,706,900 P581S probably benign Het
Ssc5d C A 7: 4,943,569 T974K probably benign Het
Tenm4 C A 7: 96,896,138 R2491S probably damaging Het
Tex2 T C 11: 106,546,753 E697G unknown Het
Tmem44 A T 16: 30,547,408 F67I possibly damaging Het
Trpm6 A T 19: 18,813,482 Q627L probably damaging Het
Ttc39a A G 4: 109,421,373 D77G possibly damaging Het
Ttc9 A G 12: 81,663,527 I198V probably benign Het
Ttn C T 2: 76,831,206 V11942M unknown Het
Uqcrc2 T A 7: 120,637,895 Y55* probably null Het
Vmn1r160 A T 7: 22,871,848 M209L probably benign Het
Vmn2r50 A T 7: 10,038,033 C580* probably null Het
Vmn2r96 A G 17: 18,573,496 E34G probably benign Het
Zmynd8 C T 2: 165,812,348 probably null Het
Other mutations in Adgrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Adgrd1 APN 5 129139592 missense probably benign 0.06
IGL01384:Adgrd1 APN 5 129097209 missense possibly damaging 0.47
IGL01636:Adgrd1 APN 5 129142452 splice site probably benign
IGL01916:Adgrd1 APN 5 129132838 missense probably benign 0.12
IGL01923:Adgrd1 APN 5 129178079 missense possibly damaging 0.58
IGL02019:Adgrd1 APN 5 129115138 missense probably benign 0.00
IGL02142:Adgrd1 APN 5 129131584 missense probably benign
IGL02149:Adgrd1 APN 5 129179261 missense probably damaging 1.00
IGL02190:Adgrd1 APN 5 129140724 splice site probably benign
IGL02623:Adgrd1 APN 5 129132745 missense probably damaging 0.99
IGL02696:Adgrd1 APN 5 129140854 splice site probably benign
IGL02850:Adgrd1 APN 5 129115055 missense probably damaging 1.00
IGL02976:Adgrd1 APN 5 129131597 missense probably benign 0.00
IGL02988:Adgrd1 UTSW 5 129144010 missense probably benign 0.00
PIT4458001:Adgrd1 UTSW 5 129131577 missense probably damaging 1.00
R0081:Adgrd1 UTSW 5 129178082 missense probably damaging 0.99
R0266:Adgrd1 UTSW 5 129139594 missense probably benign 0.00
R0267:Adgrd1 UTSW 5 129139594 missense probably benign 0.00
R0464:Adgrd1 UTSW 5 129162650 missense probably damaging 1.00
R0625:Adgrd1 UTSW 5 129171931 critical splice donor site probably null
R1288:Adgrd1 UTSW 5 129129007 missense probably damaging 0.97
R1460:Adgrd1 UTSW 5 129122563 missense possibly damaging 0.63
R1635:Adgrd1 UTSW 5 129128907 missense probably damaging 1.00
R1658:Adgrd1 UTSW 5 129178100 missense probably benign 0.02
R1709:Adgrd1 UTSW 5 129179228 missense possibly damaging 0.95
R1897:Adgrd1 UTSW 5 129129001 missense probably benign 0.01
R1976:Adgrd1 UTSW 5 129140797 missense probably benign 0.06
R2049:Adgrd1 UTSW 5 129115095 missense probably benign 0.01
R2259:Adgrd1 UTSW 5 129112311 missense possibly damaging 0.92
R2295:Adgrd1 UTSW 5 129122506 missense probably benign 0.13
R3076:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R3077:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R3078:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R4581:Adgrd1 UTSW 5 129202531 missense possibly damaging 0.68
R5024:Adgrd1 UTSW 5 129171895 missense probably damaging 1.00
R5076:Adgrd1 UTSW 5 129143989 nonsense probably null
R5227:Adgrd1 UTSW 5 129122583 missense probably benign 0.00
R5453:Adgrd1 UTSW 5 129179583 missense probably damaging 0.99
R6349:Adgrd1 UTSW 5 129142539 splice site probably null
R6953:Adgrd1 UTSW 5 129115078 nonsense probably null
R7300:Adgrd1 UTSW 5 129097347 critical splice donor site probably null
R7583:Adgrd1 UTSW 5 129179588 missense probably benign 0.42
R7622:Adgrd1 UTSW 5 129139624 missense probably benign 0.27
R8205:Adgrd1 UTSW 5 129115111 missense possibly damaging 0.94
R8716:Adgrd1 UTSW 5 129188371 missense possibly damaging 0.94
R8780:Adgrd1 UTSW 5 129097074 start gained probably benign
R8850:Adgrd1 UTSW 5 129142510 missense probably benign 0.00
R9528:Adgrd1 UTSW 5 129179676 missense probably benign 0.44
R9569:Adgrd1 UTSW 5 129179637 missense possibly damaging 0.90
X0067:Adgrd1 UTSW 5 129188352 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGTCTGCCTTTGCTCAGGAG -3'
(R):5'- TGTCCATGAAGGCCTTGAG -3'

Sequencing Primer
(F):5'- GTGGTATCTGTCCTGCTCAAAGC -3'
(R):5'- CCTCTTGAAGCCTTCAGT -3'
Posted On 2022-09-12