Incidental Mutation 'R9626:Nphs1'
ID 725149
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9626 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 30458315-30487223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30467566 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 747 (K747E)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect probably benign
Transcript: ENSMUST00000006825
AA Change: K747E

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: K747E

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126297
AA Change: K733E

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: K733E

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T A 6: 50,573,950 K506N Het
Aass T A 6: 23,127,503 N37I unknown Het
Abca9 T A 11: 110,120,780 T1146S probably benign Het
Acnat2 G A 4: 49,380,179 H400Y probably damaging Het
Adgrd1 T C 5: 129,198,657 S768P probably damaging Het
Arap2 T A 5: 62,749,535 H47L probably benign Het
Armc4 G T 18: 7,211,422 C817* probably null Het
Atxn1 T A 13: 45,557,320 N712I possibly damaging Het
Bri3bp T A 5: 125,454,508 S173T probably damaging Het
Camta1 A T 4: 151,083,830 S254R probably damaging Het
Card9 T C 2: 26,357,282 E285G probably benign Het
Celf2 G A 2: 6,586,024 A320V probably benign Het
Celsr3 T C 9: 108,849,322 I3250T probably damaging Het
Cfap46 C T 7: 139,650,889 R941H Het
Cntrob T C 11: 69,311,341 H475R possibly damaging Het
Dcaf6 G A 1: 165,399,695 R288* probably null Het
Ebna1bp2 G A 4: 118,621,174 probably benign Het
Erich3 A T 3: 154,739,093 D302V probably benign Het
Fbxo48 T A 11: 16,954,333 *162K probably null Het
Fyttd1 T C 16: 32,905,545 L290S probably damaging Het
Gcc1 T C 6: 28,418,918 D472G probably damaging Het
Gjb4 C T 4: 127,352,288 probably benign Het
Gm5157 G T 7: 21,185,471 T49K probably damaging Het
Gpr143 GTTTTTT GTTTTTTT X: 152,795,631 probably null Het
Hnrnpm G T 17: 33,677,290 D88E probably damaging Het
Hormad2 G A 11: 4,427,372 P22L probably damaging Het
Hunk C T 16: 90,475,903 T365M probably damaging Het
Lamb1 A G 12: 31,304,670 D972G probably benign Het
Mamdc4 A G 2: 25,568,261 L379P probably damaging Het
Mcrs1 A G 15: 99,248,472 L179P probably damaging Het
Mterf2 C T 10: 85,120,431 A110T probably benign Het
Mucl1 A G 15: 103,753,668 S91P possibly damaging Het
Myo1d C A 11: 80,557,470 G943V possibly damaging Het
Ndst4 A C 3: 125,683,180 D18A probably damaging Het
Ndufv1 A T 19: 4,008,064 C382* probably null Het
Npc1l1 T C 11: 6,227,854 K519E probably benign Het
Nubp2 C G 17: 24,884,400 probably null Het
Olfr1352 T G 10: 78,984,379 D196E probably benign Het
Olfr1447 A T 19: 12,901,236 D181E possibly damaging Het
Olfr19 A G 16: 16,673,627 M118T probably damaging Het
Olfr525 T C 7: 140,323,323 V208A probably benign Het
Olfr912 A G 9: 38,581,681 T135A probably benign Het
Pcdhac2 T G 18: 37,146,502 L845R probably damaging Het
Pcdhb14 A C 18: 37,448,734 T298P probably damaging Het
Phldb2 A T 16: 45,772,184 L957Q possibly damaging Het
Pole A G 5: 110,312,093 D1121G possibly damaging Het
Ppp1r3g C A 13: 35,969,629 T344K probably benign Het
Prpf8 A G 11: 75,494,855 K954R possibly damaging Het
Prr15l C A 11: 96,934,614 Y23* probably null Het
Sap18b A G 8: 95,825,470 E36G possibly damaging Het
Slc46a2 A T 4: 59,914,241 F227L probably benign Het
Spata13 C T 14: 60,706,900 P581S probably benign Het
Ssc5d C A 7: 4,943,569 T974K probably benign Het
Tenm4 C A 7: 96,896,138 R2491S probably damaging Het
Tex2 T C 11: 106,546,753 E697G unknown Het
Tmem44 A T 16: 30,547,408 F67I possibly damaging Het
Trpm6 A T 19: 18,813,482 Q627L probably damaging Het
Ttc39a A G 4: 109,421,373 D77G possibly damaging Het
Ttc9 A G 12: 81,663,527 I198V probably benign Het
Ttn C T 2: 76,831,206 V11942M unknown Het
Uqcrc2 T A 7: 120,637,895 Y55* probably null Het
Vmn1r160 A T 7: 22,871,848 M209L probably benign Het
Vmn2r50 A T 7: 10,038,033 C580* probably null Het
Vmn2r96 A G 17: 18,573,496 E34G probably benign Het
Zmynd8 C T 2: 165,812,348 probably null Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30482053 missense probably benign 0.02
R8485:Nphs1 UTSW 7 30466173 missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30463859 missense probably damaging 1.00
R8890:Nphs1 UTSW 7 30462655 missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30463200 missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30460667 nonsense probably null
R9159:Nphs1 UTSW 7 30465601 missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30471169 missense probably damaging 1.00
R9547:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9548:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9607:Nphs1 UTSW 7 30463587 missense probably damaging 1.00
R9720:Nphs1 UTSW 7 30466074 missense possibly damaging 0.83
R9733:Nphs1 UTSW 7 30467530 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30460350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAGATTCAGGAGGCTGG -3'
(R):5'- GCTTGCCCTTTATGGAAGAGAATTC -3'

Sequencing Primer
(F):5'- CTGGGCGGGACTTCCAG -3'
(R):5'- GCCCTTTATGGAAGAGAATTCTCAAG -3'
Posted On 2022-09-12