Incidental Mutation 'R9626:Cntrob'
ID 725162
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Name centrobin, centrosomal BRCA2 interacting protein
Synonyms Nip2, 9830165K03Rik, Lip8
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # R9626 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 69190313-69214601 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 69202167 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 475 (H475R)
Ref Sequence ENSEMBL: ENSMUSP00000090651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092973] [ENSMUST00000123176]
AlphaFold Q8CB62
Predicted Effect possibly damaging
Transcript: ENSMUST00000092973
AA Change: H475R

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: H475R

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123176
Predicted Effect probably benign
Transcript: ENSMUST00000135979
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,127,502 (GRCm39) N37I unknown Het
Abca9 T A 11: 110,011,606 (GRCm39) T1146S probably benign Het
Acnat2 G A 4: 49,380,179 (GRCm39) H400Y probably damaging Het
Adgrd1 T C 5: 129,275,721 (GRCm39) S768P probably damaging Het
Arap2 T A 5: 62,906,878 (GRCm39) H47L probably benign Het
Atxn1 T A 13: 45,710,796 (GRCm39) N712I possibly damaging Het
Bri3bp T A 5: 125,531,572 (GRCm39) S173T probably damaging Het
Camta1 A T 4: 151,168,287 (GRCm39) S254R probably damaging Het
Card9 T C 2: 26,247,294 (GRCm39) E285G probably benign Het
Celf2 G A 2: 6,590,835 (GRCm39) A320V probably benign Het
Celsr3 T C 9: 108,726,521 (GRCm39) I3250T probably damaging Het
Cfap46 C T 7: 139,230,805 (GRCm39) R941H Het
Dcaf6 G A 1: 165,227,264 (GRCm39) R288* probably null Het
Ebna1bp2 G A 4: 118,478,371 (GRCm39) probably benign Het
Erich3 A T 3: 154,444,730 (GRCm39) D302V probably benign Het
Fbxo48 T A 11: 16,904,333 (GRCm39) *162K probably null Het
Fyttd1 T C 16: 32,725,915 (GRCm39) L290S probably damaging Het
Gcc1 T C 6: 28,418,917 (GRCm39) D472G probably damaging Het
Gjb4 C T 4: 127,246,081 (GRCm39) probably benign Het
Gm5157 G T 7: 20,919,396 (GRCm39) T49K probably damaging Het
Gpr143 GTTTTTT GTTTTTTT X: 151,578,627 (GRCm39) probably null Het
Hnrnpm G T 17: 33,896,264 (GRCm39) D88E probably damaging Het
Hormad2 G A 11: 4,377,372 (GRCm39) P22L probably damaging Het
Hunk C T 16: 90,272,791 (GRCm39) T365M probably damaging Het
Lamb1 A G 12: 31,354,669 (GRCm39) D972G probably benign Het
Mamdc4 A G 2: 25,458,273 (GRCm39) L379P probably damaging Het
Mcrs1 A G 15: 99,146,353 (GRCm39) L179P probably damaging Het
Mterf2 C T 10: 84,956,295 (GRCm39) A110T probably benign Het
Mucl1 A G 15: 103,783,934 (GRCm39) S91P possibly damaging Het
Myo1d C A 11: 80,448,296 (GRCm39) G943V possibly damaging Het
Ndst4 A C 3: 125,476,829 (GRCm39) D18A probably damaging Het
Ndufv1 A T 19: 4,058,064 (GRCm39) C382* probably null Het
Npc1l1 T C 11: 6,177,854 (GRCm39) K519E probably benign Het
Nphs1 A G 7: 30,166,991 (GRCm39) K747E probably benign Het
Nubp2 C G 17: 25,103,374 (GRCm39) probably null Het
Odad2 G T 18: 7,211,422 (GRCm39) C817* probably null Het
Or13a19 T C 7: 139,903,236 (GRCm39) V208A probably benign Het
Or5b97 A T 19: 12,878,600 (GRCm39) D181E possibly damaging Het
Or7a36 T G 10: 78,820,213 (GRCm39) D196E probably benign Het
Or7a40 A G 16: 16,491,491 (GRCm39) M118T probably damaging Het
Or8b48 A G 9: 38,492,977 (GRCm39) T135A probably benign Het
Pcdhac2 T G 18: 37,279,555 (GRCm39) L845R probably damaging Het
Pcdhb14 A C 18: 37,581,787 (GRCm39) T298P probably damaging Het
Phldb2 A T 16: 45,592,547 (GRCm39) L957Q possibly damaging Het
Pole A G 5: 110,459,959 (GRCm39) D1121G possibly damaging Het
Ppp1r3g C A 13: 36,153,612 (GRCm39) T344K probably benign Het
Prpf8 A G 11: 75,385,681 (GRCm39) K954R possibly damaging Het
Prr15l C A 11: 96,825,440 (GRCm39) Y23* probably null Het
Sap18b A G 8: 96,552,098 (GRCm39) E36G possibly damaging Het
Slc46a2 A T 4: 59,914,241 (GRCm39) F227L probably benign Het
Spata13 C T 14: 60,944,349 (GRCm39) P581S probably benign Het
Spmip4 T A 6: 50,550,930 (GRCm39) K506N Het
Ssc5d C A 7: 4,946,568 (GRCm39) T974K probably benign Het
Tenm4 C A 7: 96,545,345 (GRCm39) R2491S probably damaging Het
Tex2 T C 11: 106,437,579 (GRCm39) E697G unknown Het
Tmem44 A T 16: 30,366,226 (GRCm39) F67I possibly damaging Het
Trpm6 A T 19: 18,790,846 (GRCm39) Q627L probably damaging Het
Ttc39a A G 4: 109,278,570 (GRCm39) D77G possibly damaging Het
Ttc9 A G 12: 81,710,301 (GRCm39) I198V probably benign Het
Ttn C T 2: 76,661,550 (GRCm39) V11942M unknown Het
Uqcrc2 T A 7: 120,237,118 (GRCm39) Y55* probably null Het
Vmn1r160 A T 7: 22,571,273 (GRCm39) M209L probably benign Het
Vmn2r50 A T 7: 9,771,960 (GRCm39) C580* probably null Het
Vmn2r96 A G 17: 18,793,758 (GRCm39) E34G probably benign Het
Zmynd8 C T 2: 165,654,268 (GRCm39) probably null Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69,210,199 (GRCm39) missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69,200,853 (GRCm39) missense possibly damaging 0.90
groats UTSW 11 69,200,317 (GRCm39) nonsense probably null
BB005:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
BB015:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R0270:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69,213,694 (GRCm39) missense probably damaging 1.00
R1749:Cntrob UTSW 11 69,213,700 (GRCm39) missense probably damaging 0.99
R1775:Cntrob UTSW 11 69,211,693 (GRCm39) missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69,198,880 (GRCm39) missense probably benign 0.27
R1967:Cntrob UTSW 11 69,211,789 (GRCm39) missense probably damaging 0.97
R2495:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R3121:Cntrob UTSW 11 69,213,526 (GRCm39) nonsense probably null
R3780:Cntrob UTSW 11 69,193,708 (GRCm39) missense probably damaging 0.97
R4449:Cntrob UTSW 11 69,196,375 (GRCm39) missense probably benign 0.29
R4696:Cntrob UTSW 11 69,211,714 (GRCm39) missense probably damaging 1.00
R4841:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69,211,732 (GRCm39) missense probably damaging 0.97
R4982:Cntrob UTSW 11 69,202,188 (GRCm39) splice site probably null
R5168:Cntrob UTSW 11 69,190,816 (GRCm39) missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69,212,717 (GRCm39) missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69,205,576 (GRCm39) missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69,213,579 (GRCm39) missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69,200,201 (GRCm39) missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69,202,248 (GRCm39) missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R6964:Cntrob UTSW 11 69,200,317 (GRCm39) nonsense probably null
R7020:Cntrob UTSW 11 69,193,918 (GRCm39) critical splice donor site probably null
R7425:Cntrob UTSW 11 69,205,560 (GRCm39) nonsense probably null
R7928:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R7946:Cntrob UTSW 11 69,206,047 (GRCm39) missense possibly damaging 0.82
R8348:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8448:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8539:Cntrob UTSW 11 69,211,652 (GRCm39) missense possibly damaging 0.94
R9259:Cntrob UTSW 11 69,211,665 (GRCm39) missense possibly damaging 0.81
R9415:Cntrob UTSW 11 69,193,741 (GRCm39) missense possibly damaging 0.66
R9553:Cntrob UTSW 11 69,205,679 (GRCm39) missense probably benign 0.00
R9628:Cntrob UTSW 11 69,213,782 (GRCm39) missense possibly damaging 0.66
R9801:Cntrob UTSW 11 69,212,233 (GRCm39) missense possibly damaging 0.82
Z1177:Cntrob UTSW 11 69,202,275 (GRCm39) missense possibly damaging 0.66
Z1186:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1186:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1187:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1187:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1188:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1188:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1189:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1189:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1190:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1190:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1191:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1191:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1192:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1192:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAAGCACTTCGTGGCAACC -3'
(R):5'- TTGGTCCTTCAGGCAGATGAG -3'

Sequencing Primer
(F):5'- TTCGTGGCAACCCTCCCG -3'
(R):5'- GTTTACATTTCCCACACTTAGAAGAC -3'
Posted On 2022-09-12