Incidental Mutation 'R0763:Dnah9'
ID 72521
Institutional Source Beutler Lab
Gene Symbol Dnah9
Ensembl Gene ENSMUSG00000056752
Gene Name dynein, axonemal, heavy chain 9
Synonyms D11Ertd686e, Dnahc9
MMRRC Submission 038943-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.400) question?
Stock # R0763 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 65722150-66059379 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66046356 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 64 (H64R)
Ref Sequence ENSEMBL: ENSMUSP00000104331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080665] [ENSMUST00000108691]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000080665
AA Change: H262R

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: H262R

DomainStartEndE-ValueType
Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108691
AA Change: H64R

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104331
Gene: ENSMUSG00000056752
AA Change: H64R

DomainStartEndE-ValueType
Pfam:DHC_N1 10 457 2.3e-141 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142836
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,815,261 (GRCm39) F290V probably damaging Het
Adam26b G A 8: 43,973,601 (GRCm39) S467L probably damaging Het
Adgrv1 T A 13: 81,647,244 (GRCm39) I3099F probably damaging Het
Akap6 A G 12: 53,188,997 (GRCm39) D2137G possibly damaging Het
Arhgdig T C 17: 26,419,275 (GRCm39) Y48C probably damaging Het
Astn1 A G 1: 158,337,460 (GRCm39) I389V possibly damaging Het
Atp8a1 T C 5: 67,817,226 (GRCm39) D920G probably benign Het
BC016579 T A 16: 45,449,818 (GRCm39) N200I probably damaging Het
Casc3 T C 11: 98,722,144 (GRCm39) Y661H probably damaging Het
Cep120 A C 18: 53,854,809 (GRCm39) V442G probably benign Het
Cfap65 A G 1: 74,943,841 (GRCm39) Y1557H probably damaging Het
Chd2 G T 7: 73,097,022 (GRCm39) Q1485K possibly damaging Het
Cntrl T C 2: 35,061,078 (GRCm39) F1967L probably benign Het
Csmd1 G A 8: 17,077,300 (GRCm39) T119M possibly damaging Het
Ep400 T C 5: 110,813,703 (GRCm39) R2899G probably damaging Het
Foxl2 A C 9: 98,838,086 (GRCm39) T125P probably damaging Het
Foxred1 A T 9: 35,118,769 (GRCm39) probably null Het
H2-Eb1 T A 17: 34,533,133 (GRCm39) probably benign Het
Heatr3 T C 8: 88,884,869 (GRCm39) S378P probably damaging Het
Hectd4 T C 5: 121,445,096 (GRCm39) probably benign Het
Hps3 T G 3: 20,057,443 (GRCm39) R780S probably damaging Het
Ifi44 G A 3: 151,455,135 (GRCm39) A30V probably damaging Het
Il12rb1 G A 8: 71,265,934 (GRCm39) probably benign Het
Invs G A 4: 48,392,628 (GRCm39) G281R possibly damaging Het
Itgax C A 7: 127,747,112 (GRCm39) probably benign Het
Jade1 G T 3: 41,568,218 (GRCm39) C762F possibly damaging Het
Lama1 C T 17: 68,079,813 (GRCm39) P1229S probably damaging Het
Mmp15 C A 8: 96,094,856 (GRCm39) D243E probably benign Het
Mug2 A G 6: 122,052,253 (GRCm39) T1004A probably benign Het
Myh14 A T 7: 44,314,791 (GRCm39) V44E probably damaging Het
N4bp2l1 C A 5: 150,517,869 (GRCm39) R11S possibly damaging Het
Notch4 T A 17: 34,784,306 (GRCm39) C36* probably null Het
Nwd1 A G 8: 73,397,672 (GRCm39) D637G probably damaging Het
Ogfod1 T C 8: 94,782,264 (GRCm39) I238T probably benign Het
Pakap G A 4: 57,688,441 (GRCm39) E95K probably damaging Het
Papln A G 12: 83,838,639 (GRCm39) D1256G possibly damaging Het
Ppp1r26 T C 2: 28,340,379 (GRCm39) L3P probably damaging Het
Rbm10 C T X: 20,503,903 (GRCm39) probably benign Het
Slc17a5 A T 9: 78,460,372 (GRCm39) probably benign Het
Slc25a17 A G 15: 81,207,907 (GRCm39) probably benign Het
Socs4 T C 14: 47,528,112 (GRCm39) F349S probably damaging Het
Spata31f1a A G 4: 42,851,238 (GRCm39) V306A probably damaging Het
Tchhl1 A C 3: 93,378,878 (GRCm39) E527D probably benign Het
Tm7sf3 A G 6: 146,507,787 (GRCm39) L425S possibly damaging Het
Tmem266 G T 9: 55,322,239 (GRCm39) V112L probably damaging Het
Tmem30c T A 16: 57,090,539 (GRCm39) I223F possibly damaging Het
Tomm70a G A 16: 56,942,535 (GRCm39) G104D probably benign Het
Ttc17 G T 2: 94,163,148 (GRCm39) A834E probably benign Het
Ttn C T 2: 76,561,534 (GRCm39) V20664M probably damaging Het
Zbed5 T C 5: 129,931,020 (GRCm39) V323A probably benign Het
Other mutations in Dnah9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Dnah9 APN 11 65,732,064 (GRCm39) splice site probably benign
IGL00805:Dnah9 APN 11 65,772,521 (GRCm39) missense probably benign 0.00
IGL00826:Dnah9 APN 11 65,880,768 (GRCm39) missense probably damaging 1.00
IGL01108:Dnah9 APN 11 65,740,806 (GRCm39) missense possibly damaging 0.93
IGL01152:Dnah9 APN 11 65,962,882 (GRCm39) missense probably damaging 1.00
IGL01353:Dnah9 APN 11 65,971,397 (GRCm39) missense probably damaging 1.00
IGL01364:Dnah9 APN 11 66,046,285 (GRCm39) missense probably damaging 1.00
IGL01479:Dnah9 APN 11 65,846,543 (GRCm39) missense probably benign 0.14
IGL01537:Dnah9 APN 11 65,838,506 (GRCm39) missense probably benign
IGL01565:Dnah9 APN 11 65,924,655 (GRCm39) missense possibly damaging 0.95
IGL01597:Dnah9 APN 11 66,009,656 (GRCm39) missense probably damaging 1.00
IGL01619:Dnah9 APN 11 65,722,441 (GRCm39) nonsense probably null
IGL01625:Dnah9 APN 11 65,935,471 (GRCm39) missense probably damaging 1.00
IGL01803:Dnah9 APN 11 66,009,655 (GRCm39) missense probably damaging 1.00
IGL01819:Dnah9 APN 11 65,998,952 (GRCm39) missense probably benign 0.33
IGL01896:Dnah9 APN 11 66,021,492 (GRCm39) missense possibly damaging 0.89
IGL01922:Dnah9 APN 11 65,965,860 (GRCm39) splice site probably benign
IGL01923:Dnah9 APN 11 66,016,061 (GRCm39) splice site probably benign
IGL02059:Dnah9 APN 11 65,963,784 (GRCm39) missense probably damaging 1.00
IGL02068:Dnah9 APN 11 65,951,871 (GRCm39) missense probably damaging 1.00
IGL02135:Dnah9 APN 11 66,008,318 (GRCm39) missense possibly damaging 0.63
IGL02146:Dnah9 APN 11 65,818,526 (GRCm39) missense probably damaging 1.00
IGL02264:Dnah9 APN 11 65,971,314 (GRCm39) splice site probably benign
IGL02325:Dnah9 APN 11 65,725,043 (GRCm39) missense probably damaging 1.00
IGL02426:Dnah9 APN 11 66,015,979 (GRCm39) missense probably benign
IGL02440:Dnah9 APN 11 65,846,072 (GRCm39) missense probably damaging 1.00
IGL02471:Dnah9 APN 11 65,838,444 (GRCm39) nonsense probably null
IGL02496:Dnah9 APN 11 65,920,189 (GRCm39) missense probably damaging 1.00
IGL02672:Dnah9 APN 11 65,818,427 (GRCm39) missense probably benign 0.02
IGL02718:Dnah9 APN 11 65,777,466 (GRCm39) missense probably damaging 0.99
IGL02832:Dnah9 APN 11 65,931,172 (GRCm39) missense probably damaging 1.00
IGL02851:Dnah9 APN 11 65,928,570 (GRCm39) splice site probably benign
IGL02859:Dnah9 APN 11 65,772,445 (GRCm39) splice site probably benign
IGL02864:Dnah9 APN 11 65,951,829 (GRCm39) missense probably damaging 1.00
IGL02954:Dnah9 APN 11 66,009,793 (GRCm39) missense probably damaging 1.00
IGL02987:Dnah9 APN 11 65,732,099 (GRCm39) missense probably benign 0.23
IGL02987:Dnah9 APN 11 65,746,098 (GRCm39) missense probably damaging 0.98
IGL03160:Dnah9 APN 11 65,998,880 (GRCm39) missense probably damaging 0.98
IGL03171:Dnah9 APN 11 65,872,067 (GRCm39) missense probably benign 0.13
IGL03180:Dnah9 APN 11 65,777,465 (GRCm39) missense probably damaging 0.99
IGL03388:Dnah9 APN 11 65,838,368 (GRCm39) missense probably damaging 1.00
anarchy UTSW 11 65,846,074 (GRCm39) missense probably damaging 0.99
sacco UTSW 11 66,058,905 (GRCm39) missense possibly damaging 0.82
Tweed UTSW 11 65,962,898 (GRCm39) missense probably damaging 0.99
vanzetti UTSW 11 65,746,198 (GRCm39) nonsense probably null
IGL02837:Dnah9 UTSW 11 65,765,022 (GRCm39) missense probably damaging 1.00
PIT4280001:Dnah9 UTSW 11 65,895,839 (GRCm39) missense probably benign 0.44
R0021:Dnah9 UTSW 11 65,860,805 (GRCm39) missense probably benign 0.36
R0021:Dnah9 UTSW 11 65,860,805 (GRCm39) missense probably benign 0.36
R0025:Dnah9 UTSW 11 65,860,781 (GRCm39) splice site probably benign
R0025:Dnah9 UTSW 11 65,860,781 (GRCm39) splice site probably benign
R0070:Dnah9 UTSW 11 66,050,866 (GRCm39) missense probably benign 0.10
R0164:Dnah9 UTSW 11 65,809,630 (GRCm39) nonsense probably null
R0164:Dnah9 UTSW 11 65,809,630 (GRCm39) nonsense probably null
R0180:Dnah9 UTSW 11 66,038,116 (GRCm39) missense probably damaging 1.00
R0195:Dnah9 UTSW 11 65,786,731 (GRCm39) missense probably benign 0.30
R0230:Dnah9 UTSW 11 65,746,141 (GRCm39) missense probably damaging 1.00
R0243:Dnah9 UTSW 11 65,802,678 (GRCm39) missense possibly damaging 0.91
R0279:Dnah9 UTSW 11 65,802,615 (GRCm39) critical splice donor site probably null
R0288:Dnah9 UTSW 11 65,915,960 (GRCm39) critical splice donor site probably null
R0309:Dnah9 UTSW 11 65,917,798 (GRCm39) splice site probably benign
R0356:Dnah9 UTSW 11 66,021,388 (GRCm39) critical splice donor site probably null
R0403:Dnah9 UTSW 11 65,975,615 (GRCm39) missense possibly damaging 0.90
R0413:Dnah9 UTSW 11 65,998,961 (GRCm39) missense probably damaging 1.00
R0448:Dnah9 UTSW 11 65,809,539 (GRCm39) splice site probably benign
R0496:Dnah9 UTSW 11 65,965,961 (GRCm39) missense probably null 1.00
R0557:Dnah9 UTSW 11 65,975,492 (GRCm39) missense probably damaging 1.00
R0584:Dnah9 UTSW 11 65,881,315 (GRCm39) missense probably damaging 1.00
R0598:Dnah9 UTSW 11 66,009,703 (GRCm39) missense probably benign 0.02
R0599:Dnah9 UTSW 11 65,856,515 (GRCm39) missense probably damaging 1.00
R0606:Dnah9 UTSW 11 65,732,159 (GRCm39) missense probably damaging 1.00
R0666:Dnah9 UTSW 11 65,976,284 (GRCm39) missense probably benign 0.01
R0715:Dnah9 UTSW 11 65,972,074 (GRCm39) splice site probably benign
R0726:Dnah9 UTSW 11 65,856,507 (GRCm39) missense probably damaging 1.00
R0737:Dnah9 UTSW 11 65,998,724 (GRCm39) missense probably damaging 1.00
R0792:Dnah9 UTSW 11 65,786,827 (GRCm39) missense possibly damaging 0.84
R0829:Dnah9 UTSW 11 65,896,002 (GRCm39) missense probably benign 0.00
R0973:Dnah9 UTSW 11 65,896,663 (GRCm39) splice site probably null
R0974:Dnah9 UTSW 11 65,896,663 (GRCm39) splice site probably null
R1055:Dnah9 UTSW 11 66,050,837 (GRCm39) missense probably damaging 1.00
R1081:Dnah9 UTSW 11 65,975,703 (GRCm39) missense probably damaging 0.99
R1184:Dnah9 UTSW 11 65,975,438 (GRCm39) critical splice donor site probably null
R1225:Dnah9 UTSW 11 65,761,886 (GRCm39) missense possibly damaging 0.94
R1304:Dnah9 UTSW 11 65,818,414 (GRCm39) missense probably damaging 0.98
R1417:Dnah9 UTSW 11 65,846,573 (GRCm39) missense probably damaging 0.96
R1439:Dnah9 UTSW 11 65,764,958 (GRCm39) missense probably benign 0.22
R1447:Dnah9 UTSW 11 65,999,308 (GRCm39) missense possibly damaging 0.65
R1450:Dnah9 UTSW 11 65,818,612 (GRCm39) missense probably damaging 1.00
R1470:Dnah9 UTSW 11 65,818,648 (GRCm39) missense probably benign 0.11
R1470:Dnah9 UTSW 11 65,818,648 (GRCm39) missense probably benign 0.11
R1486:Dnah9 UTSW 11 65,725,098 (GRCm39) missense probably damaging 1.00
R1519:Dnah9 UTSW 11 65,772,587 (GRCm39) missense probably damaging 0.96
R1570:Dnah9 UTSW 11 66,003,156 (GRCm39) missense probably benign
R1617:Dnah9 UTSW 11 65,786,747 (GRCm39) missense probably damaging 1.00
R1623:Dnah9 UTSW 11 65,928,463 (GRCm39) missense probably damaging 1.00
R1626:Dnah9 UTSW 11 65,976,093 (GRCm39) missense probably benign 0.05
R1671:Dnah9 UTSW 11 65,818,789 (GRCm39) missense probably damaging 0.99
R1694:Dnah9 UTSW 11 65,845,650 (GRCm39) nonsense probably null
R1701:Dnah9 UTSW 11 65,802,750 (GRCm39) missense probably damaging 1.00
R1702:Dnah9 UTSW 11 65,976,021 (GRCm39) missense possibly damaging 0.72
R1708:Dnah9 UTSW 11 65,805,980 (GRCm39) missense probably benign 0.11
R1718:Dnah9 UTSW 11 66,058,905 (GRCm39) missense possibly damaging 0.82
R1729:Dnah9 UTSW 11 65,975,846 (GRCm39) missense possibly damaging 0.51
R1760:Dnah9 UTSW 11 65,872,048 (GRCm39) missense probably benign 0.31
R1784:Dnah9 UTSW 11 65,975,846 (GRCm39) missense possibly damaging 0.51
R1793:Dnah9 UTSW 11 66,010,420 (GRCm39) critical splice donor site probably null
R1801:Dnah9 UTSW 11 65,846,123 (GRCm39) missense probably damaging 0.99
R1827:Dnah9 UTSW 11 65,740,887 (GRCm39) missense probably damaging 0.97
R1836:Dnah9 UTSW 11 66,009,667 (GRCm39) missense probably benign 0.10
R1840:Dnah9 UTSW 11 65,725,024 (GRCm39) nonsense probably null
R1847:Dnah9 UTSW 11 65,725,212 (GRCm39) missense probably damaging 1.00
R1872:Dnah9 UTSW 11 65,928,316 (GRCm39) missense probably benign 0.16
R1929:Dnah9 UTSW 11 65,867,224 (GRCm39) missense probably benign 0.05
R1969:Dnah9 UTSW 11 65,739,197 (GRCm39) missense probably damaging 1.00
R1971:Dnah9 UTSW 11 65,739,197 (GRCm39) missense probably damaging 1.00
R2027:Dnah9 UTSW 11 65,846,164 (GRCm39) missense probably benign 0.11
R2049:Dnah9 UTSW 11 65,935,509 (GRCm39) missense probably damaging 1.00
R2064:Dnah9 UTSW 11 66,036,261 (GRCm39) missense probably benign 0.31
R2104:Dnah9 UTSW 11 65,951,950 (GRCm39) missense probably damaging 1.00
R2109:Dnah9 UTSW 11 65,928,411 (GRCm39) missense probably damaging 1.00
R2160:Dnah9 UTSW 11 66,008,309 (GRCm39) missense probably damaging 1.00
R2172:Dnah9 UTSW 11 65,963,605 (GRCm39) missense probably damaging 1.00
R2198:Dnah9 UTSW 11 65,750,325 (GRCm39) missense possibly damaging 0.50
R2271:Dnah9 UTSW 11 66,003,188 (GRCm39) missense probably benign 0.37
R2272:Dnah9 UTSW 11 66,003,188 (GRCm39) missense probably benign 0.37
R2396:Dnah9 UTSW 11 65,975,984 (GRCm39) missense probably benign 0.01
R2398:Dnah9 UTSW 11 65,806,029 (GRCm39) missense probably damaging 1.00
R2418:Dnah9 UTSW 11 65,986,241 (GRCm39) nonsense probably null
R2419:Dnah9 UTSW 11 65,986,241 (GRCm39) nonsense probably null
R2510:Dnah9 UTSW 11 65,895,995 (GRCm39) missense probably damaging 1.00
R2680:Dnah9 UTSW 11 65,924,751 (GRCm39) missense probably benign 0.00
R2875:Dnah9 UTSW 11 66,059,287 (GRCm39) missense possibly damaging 0.89
R2979:Dnah9 UTSW 11 66,008,414 (GRCm39) missense possibly damaging 0.89
R3236:Dnah9 UTSW 11 65,845,815 (GRCm39) missense probably benign 0.11
R3237:Dnah9 UTSW 11 65,845,815 (GRCm39) missense probably benign 0.11
R3433:Dnah9 UTSW 11 65,965,938 (GRCm39) missense possibly damaging 0.85
R3737:Dnah9 UTSW 11 66,047,734 (GRCm39) nonsense probably null
R3820:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3821:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3822:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3861:Dnah9 UTSW 11 65,943,820 (GRCm39) splice site probably benign
R3918:Dnah9 UTSW 11 65,761,800 (GRCm39) missense possibly damaging 0.54
R4011:Dnah9 UTSW 11 65,725,290 (GRCm39) missense probably damaging 0.98
R4044:Dnah9 UTSW 11 66,024,461 (GRCm39) missense probably benign 0.03
R4072:Dnah9 UTSW 11 65,975,730 (GRCm39) missense probably benign 0.00
R4076:Dnah9 UTSW 11 65,975,730 (GRCm39) missense probably benign 0.00
R4097:Dnah9 UTSW 11 65,881,285 (GRCm39) missense probably damaging 1.00
R4409:Dnah9 UTSW 11 65,976,303 (GRCm39) missense possibly damaging 0.51
R4410:Dnah9 UTSW 11 65,976,303 (GRCm39) missense possibly damaging 0.51
R4417:Dnah9 UTSW 11 65,872,040 (GRCm39) missense possibly damaging 0.75
R4420:Dnah9 UTSW 11 66,009,575 (GRCm39) missense probably benign 0.00
R4434:Dnah9 UTSW 11 65,998,901 (GRCm39) missense possibly damaging 0.67
R4451:Dnah9 UTSW 11 65,772,467 (GRCm39) missense probably benign 0.07
R4452:Dnah9 UTSW 11 65,917,908 (GRCm39) missense probably damaging 0.96
R4454:Dnah9 UTSW 11 66,038,215 (GRCm39) missense probably damaging 0.96
R4551:Dnah9 UTSW 11 65,732,192 (GRCm39) missense probably damaging 1.00
R4552:Dnah9 UTSW 11 65,732,192 (GRCm39) missense probably damaging 1.00
R4590:Dnah9 UTSW 11 65,931,218 (GRCm39) missense probably damaging 1.00
R4595:Dnah9 UTSW 11 66,058,978 (GRCm39) missense probably benign
R4655:Dnah9 UTSW 11 65,846,558 (GRCm39) missense probably benign 0.00
R4667:Dnah9 UTSW 11 66,046,357 (GRCm39) missense probably benign
R4718:Dnah9 UTSW 11 65,976,299 (GRCm39) missense probably benign
R4720:Dnah9 UTSW 11 65,967,184 (GRCm39) missense probably damaging 1.00
R4734:Dnah9 UTSW 11 65,724,941 (GRCm39) missense probably damaging 1.00
R4749:Dnah9 UTSW 11 65,724,941 (GRCm39) missense probably damaging 1.00
R4765:Dnah9 UTSW 11 65,818,552 (GRCm39) missense probably damaging 1.00
R4905:Dnah9 UTSW 11 65,764,950 (GRCm39) nonsense probably null
R4963:Dnah9 UTSW 11 65,975,437 (GRCm39) splice site probably null
R5074:Dnah9 UTSW 11 65,740,866 (GRCm39) missense probably damaging 1.00
R5230:Dnah9 UTSW 11 65,975,492 (GRCm39) missense probably damaging 0.99
R5262:Dnah9 UTSW 11 66,003,159 (GRCm39) missense probably benign 0.34
R5364:Dnah9 UTSW 11 65,772,522 (GRCm39) missense possibly damaging 0.93
R5370:Dnah9 UTSW 11 65,920,180 (GRCm39) missense probably damaging 1.00
R5386:Dnah9 UTSW 11 65,920,182 (GRCm39) missense probably damaging 1.00
R5389:Dnah9 UTSW 11 65,986,140 (GRCm39) nonsense probably null
R5541:Dnah9 UTSW 11 66,036,162 (GRCm39) missense probably damaging 1.00
R5560:Dnah9 UTSW 11 65,772,566 (GRCm39) missense probably benign 0.00
R5576:Dnah9 UTSW 11 65,724,922 (GRCm39) splice site probably null
R5648:Dnah9 UTSW 11 65,818,581 (GRCm39) missense probably benign 0.00
R5653:Dnah9 UTSW 11 65,740,806 (GRCm39) missense probably damaging 0.99
R5713:Dnah9 UTSW 11 65,916,049 (GRCm39) missense possibly damaging 0.92
R5763:Dnah9 UTSW 11 65,846,065 (GRCm39) missense probably damaging 1.00
R5825:Dnah9 UTSW 11 66,017,427 (GRCm39) missense probably benign 0.01
R5831:Dnah9 UTSW 11 65,998,947 (GRCm39) missense probably benign 0.00
R5847:Dnah9 UTSW 11 65,986,066 (GRCm39) frame shift probably null
R5870:Dnah9 UTSW 11 65,976,036 (GRCm39) missense probably benign 0.01
R5902:Dnah9 UTSW 11 65,916,013 (GRCm39) missense probably benign 0.08
R5918:Dnah9 UTSW 11 65,725,025 (GRCm39) missense probably damaging 1.00
R5979:Dnah9 UTSW 11 65,725,307 (GRCm39) missense probably damaging 1.00
R6065:Dnah9 UTSW 11 66,036,223 (GRCm39) missense possibly damaging 0.65
R6065:Dnah9 UTSW 11 65,746,164 (GRCm39) missense probably benign 0.05
R6086:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
R6086:Dnah9 UTSW 11 65,880,741 (GRCm39) missense probably damaging 0.99
R6102:Dnah9 UTSW 11 65,881,342 (GRCm39) missense probably damaging 0.97
R6120:Dnah9 UTSW 11 66,038,225 (GRCm39) missense probably benign
R6154:Dnah9 UTSW 11 65,746,164 (GRCm39) missense probably benign 0.00
R6262:Dnah9 UTSW 11 65,772,631 (GRCm39) splice site probably null
R6265:Dnah9 UTSW 11 66,058,920 (GRCm39) missense probably benign 0.04
R6290:Dnah9 UTSW 11 65,732,201 (GRCm39) missense probably damaging 1.00
R6345:Dnah9 UTSW 11 65,928,519 (GRCm39) missense probably damaging 0.97
R6357:Dnah9 UTSW 11 65,765,022 (GRCm39) missense probably damaging 1.00
R6534:Dnah9 UTSW 11 65,846,074 (GRCm39) missense probably damaging 0.99
R6574:Dnah9 UTSW 11 66,059,107 (GRCm39) missense probably benign 0.37
R6582:Dnah9 UTSW 11 65,951,923 (GRCm39) missense probably damaging 1.00
R6700:Dnah9 UTSW 11 65,846,192 (GRCm39) missense probably damaging 1.00
R6800:Dnah9 UTSW 11 65,963,565 (GRCm39) critical splice donor site probably null
R6812:Dnah9 UTSW 11 65,872,155 (GRCm39) missense probably damaging 0.99
R6931:Dnah9 UTSW 11 66,008,452 (GRCm39) missense possibly damaging 0.63
R6944:Dnah9 UTSW 11 65,975,975 (GRCm39) missense possibly damaging 0.91
R6958:Dnah9 UTSW 11 65,967,167 (GRCm39) missense probably damaging 1.00
R6977:Dnah9 UTSW 11 65,998,735 (GRCm39) missense probably benign 0.37
R7021:Dnah9 UTSW 11 65,872,057 (GRCm39) missense probably benign
R7161:Dnah9 UTSW 11 65,746,198 (GRCm39) nonsense probably null
R7175:Dnah9 UTSW 11 66,024,463 (GRCm39) missense probably benign 0.03
R7199:Dnah9 UTSW 11 66,009,770 (GRCm39) missense probably benign 0.04
R7231:Dnah9 UTSW 11 65,856,473 (GRCm39) missense probably damaging 1.00
R7284:Dnah9 UTSW 11 65,881,302 (GRCm39) missense probably damaging 0.99
R7314:Dnah9 UTSW 11 65,880,677 (GRCm39) missense probably benign 0.00
R7350:Dnah9 UTSW 11 65,971,404 (GRCm39) missense probably damaging 1.00
R7420:Dnah9 UTSW 11 66,008,233 (GRCm39) critical splice donor site probably null
R7427:Dnah9 UTSW 11 65,846,045 (GRCm39) missense probably benign
R7477:Dnah9 UTSW 11 65,883,557 (GRCm39) missense probably damaging 0.98
R7515:Dnah9 UTSW 11 65,732,240 (GRCm39) missense probably benign 0.01
R7521:Dnah9 UTSW 11 65,880,663 (GRCm39) missense probably damaging 0.98
R7573:Dnah9 UTSW 11 66,016,041 (GRCm39) missense probably benign 0.43
R7659:Dnah9 UTSW 11 65,880,606 (GRCm39) missense probably damaging 0.99
R7707:Dnah9 UTSW 11 66,009,784 (GRCm39) missense probably damaging 1.00
R7749:Dnah9 UTSW 11 65,802,656 (GRCm39) missense probably damaging 1.00
R7792:Dnah9 UTSW 11 65,740,839 (GRCm39) missense probably damaging 1.00
R7808:Dnah9 UTSW 11 65,896,631 (GRCm39) nonsense probably null
R7814:Dnah9 UTSW 11 65,896,486 (GRCm39) missense probably damaging 1.00
R7818:Dnah9 UTSW 11 65,916,037 (GRCm39) missense possibly damaging 0.64
R7890:Dnah9 UTSW 11 65,962,898 (GRCm39) missense probably damaging 0.99
R7976:Dnah9 UTSW 11 65,732,227 (GRCm39) missense possibly damaging 0.91
R8121:Dnah9 UTSW 11 65,908,201 (GRCm39) missense probably benign 0.02
R8232:Dnah9 UTSW 11 65,746,149 (GRCm39) missense possibly damaging 0.91
R8311:Dnah9 UTSW 11 65,880,644 (GRCm39) missense probably benign 0.00
R8326:Dnah9 UTSW 11 66,008,452 (GRCm39) missense probably benign 0.01
R8338:Dnah9 UTSW 11 65,732,067 (GRCm39) critical splice donor site probably null
R8356:Dnah9 UTSW 11 66,047,764 (GRCm39) missense probably damaging 0.99
R8456:Dnah9 UTSW 11 66,047,764 (GRCm39) missense probably damaging 0.99
R8468:Dnah9 UTSW 11 65,722,556 (GRCm39) missense probably benign 0.00
R8721:Dnah9 UTSW 11 65,986,124 (GRCm39) missense probably damaging 1.00
R8747:Dnah9 UTSW 11 65,818,816 (GRCm39) missense possibly damaging 0.69
R8798:Dnah9 UTSW 11 65,796,057 (GRCm39) missense probably damaging 0.99
R8806:Dnah9 UTSW 11 65,750,309 (GRCm39) missense probably damaging 1.00
R8826:Dnah9 UTSW 11 65,740,742 (GRCm39) missense probably benign 0.13
R8837:Dnah9 UTSW 11 65,746,060 (GRCm39) missense possibly damaging 0.72
R8886:Dnah9 UTSW 11 65,943,840 (GRCm39) missense probably damaging 1.00
R8887:Dnah9 UTSW 11 65,746,210 (GRCm39) missense probably benign 0.01
R8921:Dnah9 UTSW 11 65,802,747 (GRCm39) missense probably benign
R8933:Dnah9 UTSW 11 65,746,078 (GRCm39) missense possibly damaging 0.88
R8949:Dnah9 UTSW 11 66,059,226 (GRCm39) missense possibly damaging 0.91
R8967:Dnah9 UTSW 11 66,015,938 (GRCm39) critical splice donor site probably null
R8979:Dnah9 UTSW 11 65,895,978 (GRCm39) missense probably benign
R8991:Dnah9 UTSW 11 65,777,506 (GRCm39) missense probably damaging 0.96
R9016:Dnah9 UTSW 11 65,998,856 (GRCm39) missense probably damaging 0.99
R9025:Dnah9 UTSW 11 65,896,651 (GRCm39) missense probably damaging 1.00
R9043:Dnah9 UTSW 11 65,845,680 (GRCm39) missense
R9047:Dnah9 UTSW 11 65,962,925 (GRCm39) missense possibly damaging 0.89
R9076:Dnah9 UTSW 11 66,008,464 (GRCm39) missense probably benign 0.21
R9113:Dnah9 UTSW 11 65,880,713 (GRCm39) missense probably damaging 1.00
R9152:Dnah9 UTSW 11 66,021,457 (GRCm39) missense probably damaging 1.00
R9187:Dnah9 UTSW 11 65,895,972 (GRCm39) missense probably benign
R9198:Dnah9 UTSW 11 65,846,570 (GRCm39) missense probably benign 0.02
R9203:Dnah9 UTSW 11 65,746,113 (GRCm39) missense possibly damaging 0.58
R9234:Dnah9 UTSW 11 65,924,751 (GRCm39) missense possibly damaging 0.68
R9245:Dnah9 UTSW 11 65,786,731 (GRCm39) missense probably benign 0.30
R9265:Dnah9 UTSW 11 65,732,081 (GRCm39) missense probably benign 0.01
R9307:Dnah9 UTSW 11 65,976,300 (GRCm39) missense probably benign 0.14
R9336:Dnah9 UTSW 11 65,761,775 (GRCm39) missense probably damaging 1.00
R9386:Dnah9 UTSW 11 65,838,368 (GRCm39) missense probably damaging 1.00
R9498:Dnah9 UTSW 11 65,739,199 (GRCm39) missense probably damaging 0.99
R9508:Dnah9 UTSW 11 65,725,089 (GRCm39) missense probably damaging 1.00
R9524:Dnah9 UTSW 11 65,976,309 (GRCm39) missense possibly damaging 0.92
R9577:Dnah9 UTSW 11 65,867,347 (GRCm39) missense probably benign 0.00
R9583:Dnah9 UTSW 11 65,856,507 (GRCm39) missense probably damaging 1.00
R9587:Dnah9 UTSW 11 65,999,217 (GRCm39) missense probably null 0.92
R9612:Dnah9 UTSW 11 65,818,475 (GRCm39) missense probably benign 0.00
R9748:Dnah9 UTSW 11 65,976,290 (GRCm39) missense possibly damaging 0.51
R9749:Dnah9 UTSW 11 65,986,202 (GRCm39) missense probably damaging 1.00
R9759:Dnah9 UTSW 11 65,965,944 (GRCm39) missense probably null 0.93
R9784:Dnah9 UTSW 11 65,975,960 (GRCm39) missense probably damaging 0.99
V3553:Dnah9 UTSW 11 65,860,902 (GRCm39) missense probably damaging 1.00
X0027:Dnah9 UTSW 11 65,976,305 (GRCm39) missense probably benign 0.07
X0028:Dnah9 UTSW 11 65,881,278 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,860,910 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,818,679 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,786,798 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,963,661 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,928,300 (GRCm39) missense probably damaging 1.00
Z1177:Dnah9 UTSW 11 66,017,476 (GRCm39) missense probably damaging 1.00
Z1186:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1186:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1187:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1187:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1188:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1188:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1189:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1189:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1190:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1190:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1191:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1191:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1192:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1192:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATTTGCTATTCCTGCCACCATGC -3'
(R):5'- TGCCCCAACCTTGCTGTAAGAAC -3'

Sequencing Primer
(F):5'- TGCTGTCTCATACCAGATAAGAAGG -3'
(R):5'- GTCCTCACTGTTCTGAAACAGATG -3'
Posted On 2013-09-30