Incidental Mutation 'R9627:Plxnd1'
ID 725212
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Name plexin D1
Synonyms b2b553Clo, 6230425C21Rik, b2b1863Clo
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9627 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 115954811-115995005 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 115963313 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 1370 (R1370Q)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
AlphaFold Q3UH93
Predicted Effect possibly damaging
Transcript: ENSMUST00000015511
AA Change: R1370Q

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: R1370Q

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131590
SMART Domains Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123

DomainStartEndE-ValueType
Blast:PSI 2 34 1e-13 BLAST
IPT 35 124 4.43e-20 SMART
Blast:IPT 125 177 3e-30 BLAST
Pfam:TIG 180 233 4.6e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,657,490 probably benign Het
Abca14 T C 7: 120,255,307 V898A probably benign Het
Adamtsl1 A T 4: 86,388,525 D1400V possibly damaging Het
Akap6 T A 12: 53,104,630 M1159K Het
Atg13 C A 2: 91,678,753 G446* probably null Het
Atp6v1g2 G T 17: 35,235,980 probably null Het
Bmp2k C T 5: 97,053,169 A316V possibly damaging Het
Ccdc34 AAGA AA 2: 110,040,665 probably null Het
Cln6 T A 9: 62,847,021 I115N probably damaging Het
Cma1 T C 14: 55,943,832 T39A probably benign Het
Cpsf1 A T 15: 76,599,888 M744K probably damaging Het
Csf1r A G 18: 61,127,900 Y721C probably damaging Het
Dcaf12 A G 4: 41,293,976 L387P probably benign Het
Ephb1 T C 9: 102,041,269 E347G possibly damaging Het
Fam208a T C 14: 27,472,166 S1108P probably benign Het
Fig4 T A 10: 41,232,182 H674L probably benign Het
Foxa3 T A 7: 19,014,533 K223* probably null Het
Gimap7 T C 6: 48,723,666 V62A probably damaging Het
Glrx3 T A 7: 137,445,026 V49E probably benign Het
Greb1 T C 12: 16,706,166 Y823C probably damaging Het
Hapln4 C A 8: 70,086,870 R184S possibly damaging Het
Hist1h3f G T 13: 23,544,623 V47L possibly damaging Het
Hmcn1 C T 1: 150,630,303 C3824Y probably damaging Het
Hrnr T C 3: 93,325,928 S1158P unknown Het
Itln1 A G 1: 171,533,417 S36P probably benign Het
Kcnh5 A C 12: 75,114,216 I306S probably damaging Het
Kctd19 T A 8: 105,387,365 M559L probably benign Het
Kif2a A G 13: 107,022,050 I9T possibly damaging Het
Klra5 G A 6: 129,906,738 T142I probably benign Het
Ldlrad3 A G 2: 101,955,078 V184A probably damaging Het
Lrrc27 T C 7: 139,228,666 probably benign Het
Mark1 A G 1: 184,914,620 V340A probably benign Het
Mrps31 T C 8: 22,411,542 V26A probably benign Het
Mtrr G A 13: 68,577,637 L118F probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nbas G T 12: 13,300,202 V285F possibly damaging Het
Nfrkb T C 9: 31,409,893 L675P possibly damaging Het
Olfr1418 T A 19: 11,855,546 I136F possibly damaging Het
Olfr178 T A 16: 58,889,408 I271L probably benign Het
Olfr357 T A 2: 36,997,653 V281E Het
Phkg1 C T 5: 129,864,535 W358* probably null Het
Plekhj1 A C 10: 80,797,660 I51S possibly damaging Het
Prkg2 T C 5: 98,932,010 *763W probably null Het
Rhobtb2 A G 14: 69,796,900 F292S probably damaging Het
Rlf A T 4: 121,149,805 C769* probably null Het
Rmi1 C A 13: 58,409,552 D538E possibly damaging Het
Scn4a C T 11: 106,322,013 V1389I probably benign Het
Serpinc1 A T 1: 160,993,531 K183* probably null Het
Setd4 A T 16: 93,583,674 M399K possibly damaging Het
Setx T C 2: 29,144,649 M382T probably damaging Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Slfn2 A T 11: 83,069,541 K115N Het
Snrk A T 9: 122,137,361 K117* probably null Het
Spata31 A G 13: 64,917,595 Y38C possibly damaging Het
Stab2 T C 10: 86,957,840 T464A probably damaging Het
Tagap1 C T 17: 6,956,928 G123D probably benign Het
Tas2r136 T C 6: 132,777,985 K60E possibly damaging Het
Tmem200b A C 4: 131,922,126 Y119S probably damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Wdr66 A G 5: 123,322,494 D1173G probably benign Het
Wwp2 T G 8: 107,552,327 L578W probably damaging Het
Zfp53 T A 17: 21,508,483 C259* probably null Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115967972 missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115969945 missense probably benign
IGL01323:Plxnd1 APN 6 115966799 missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115960527 missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115959935 missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115978257 missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115993628 missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115963913 missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115955742 makesense probably null
IGL02873:Plxnd1 APN 6 115959976 missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115962357 missense probably damaging 1.00
Hiss UTSW 6 115969929 missense possibly damaging 0.94
murmer UTSW 6 115968793 missense probably benign 0.00
mutter UTSW 6 115968044 missense probably benign 0.27
rattle UTSW 6 115959794 missense probably damaging 0.96
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115969460 missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115958699 splice site probably benign
R0648:Plxnd1 UTSW 6 115994001 missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115966638 missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115967005 splice site probably null
R1292:Plxnd1 UTSW 6 115962683 unclassified probably benign
R1715:Plxnd1 UTSW 6 115968681 missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115967779 missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115994057 missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115980601 missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115966546 missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115963914 missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115969441 splice site probably null
R1865:Plxnd1 UTSW 6 115969441 splice site probably null
R1875:Plxnd1 UTSW 6 115978084 splice site probably null
R1899:Plxnd1 UTSW 6 115969363 missense probably benign
R1913:Plxnd1 UTSW 6 115978017 missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115962517 missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115967255 missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115957548 missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115962764 missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115964144 missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115962743 missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115967748 critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115959315 missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115965953 missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115956094 splice site probably benign
R4280:Plxnd1 UTSW 6 115956095 splice site probably null
R4346:Plxnd1 UTSW 6 115977980 missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115993976 missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115955756 missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115968044 missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115994276 missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115972525 missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115958615 missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115958620 missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115960855 missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115955765 missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115994376 missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115965901 missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115958988 critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115957648 missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115965877 missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115968688 missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115967787 critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115978174 missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115977960 missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115978492 missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115976736 missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115969929 missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115993763 missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115972507 missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115960837 missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115976639 missense probably benign
R7699:Plxnd1 UTSW 6 115959794 missense probably damaging 0.96
R7915:Plxnd1 UTSW 6 115966918 missense probably benign 0.00
R8090:Plxnd1 UTSW 6 115956617 missense probably damaging 1.00
R8382:Plxnd1 UTSW 6 115972472 missense probably benign
R8507:Plxnd1 UTSW 6 115966905 missense probably damaging 0.97
R8539:Plxnd1 UTSW 6 115962807 missense possibly damaging 0.94
R8548:Plxnd1 UTSW 6 115957597 missense probably damaging 1.00
R8963:Plxnd1 UTSW 6 115972545 nonsense probably null
R9119:Plxnd1 UTSW 6 115955871 splice site probably benign
R9177:Plxnd1 UTSW 6 115966508 missense probably benign 0.00
R9182:Plxnd1 UTSW 6 115993785 missense probably damaging 0.98
R9185:Plxnd1 UTSW 6 115957565 missense probably damaging 1.00
R9226:Plxnd1 UTSW 6 115957563 missense probably damaging 1.00
R9433:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R9449:Plxnd1 UTSW 6 115955769 missense probably damaging 1.00
R9451:Plxnd1 UTSW 6 115963316 missense possibly damaging 0.72
R9599:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
R9644:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
R9672:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
X0024:Plxnd1 UTSW 6 115963310 missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115966784 missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115967510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGAACGGCTGAGTGAATGCC -3'
(R):5'- GCTTTTCTCAACCTCAGAACAC -3'

Sequencing Primer
(F):5'- CTGAGTGAATGCCTCCTAGAAG -3'
(R):5'- GAACACAGCAGCTTGCCTG -3'
Posted On 2022-09-12