Incidental Mutation 'R0763:Casc3'
ID72522
Institutional Source Beutler Lab
Gene Symbol Casc3
Ensembl Gene ENSMUSG00000078676
Gene Namecancer susceptibility candidate 3
SynonymsBtz, Mln51
MMRRC Submission 038943-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R0763 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98804905-98833814 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98831318 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 661 (Y661H)
Ref Sequence ENSEMBL: ENSMUSP00000130926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017384] [ENSMUST00000169695]
Predicted Effect probably damaging
Transcript: ENSMUST00000017384
AA Change: Y661H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017384
Gene: ENSMUSG00000078676
AA Change: Y661H

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169695
AA Change: Y661H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130926
Gene: ENSMUSG00000078676
AA Change: Y661H

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Meta Mutation Damage Score 0.3264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a core component of the exon junction complex (EJC), a protein complex that is deposited on spliced mRNAs at exon-exon junctions and functions in nonsense-mediated mRNA decay (NMD). The encoded protein binds RNA and interacts with two other EJC core components. It is predominantly located in the cytoplasm, but shuttles into the nucleus where it localizes to nuclear speckles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for a null or hypomorphic allele causes embryonic and postnatal lethality, respectively. Compound heterozygous embryos are smaller and exhibit proportionately reduced brain size with fewer neurons and progenitors, but no apoptosis, largely due to developmental delay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,838,279 F290V probably damaging Het
Adam26b G A 8: 43,520,564 S467L probably damaging Het
Adgrv1 T A 13: 81,499,125 I3099F probably damaging Het
Akap6 A G 12: 53,142,214 D2137G possibly damaging Het
Arhgdig T C 17: 26,200,301 Y48C probably damaging Het
Astn1 A G 1: 158,509,890 I389V possibly damaging Het
Atp8a1 T C 5: 67,659,883 D920G probably benign Het
BC016579 T A 16: 45,629,455 N200I probably damaging Het
Cep120 A C 18: 53,721,737 V442G probably benign Het
Cfap65 A G 1: 74,904,682 Y1557H probably damaging Het
Chd2 G T 7: 73,447,274 Q1485K possibly damaging Het
Cntrl T C 2: 35,171,066 F1967L probably benign Het
Csmd1 G A 8: 17,027,284 T119M possibly damaging Het
Dnah9 T C 11: 66,155,530 H64R probably benign Het
Ep400 T C 5: 110,665,837 R2899G probably damaging Het
Fam205a1 A G 4: 42,851,238 V306A probably damaging Het
Foxl2 A C 9: 98,956,033 T125P probably damaging Het
Foxred1 A T 9: 35,207,473 probably null Het
H2-Eb1 T A 17: 34,314,159 probably benign Het
Heatr3 T C 8: 88,158,241 S378P probably damaging Het
Hectd4 T C 5: 121,307,033 probably benign Het
Hps3 T G 3: 20,003,279 R780S probably damaging Het
Ifi44 G A 3: 151,749,498 A30V probably damaging Het
Il12rb1 G A 8: 70,813,290 probably benign Het
Invs G A 4: 48,392,628 G281R possibly damaging Het
Itgax C A 7: 128,147,940 probably benign Het
Jade1 G T 3: 41,613,783 C762F possibly damaging Het
Lama1 C T 17: 67,772,818 P1229S probably damaging Het
Mmp15 C A 8: 95,368,228 D243E probably benign Het
Mug2 A G 6: 122,075,294 T1004A probably benign Het
Myh14 A T 7: 44,665,367 V44E probably damaging Het
N4bp2l1 C A 5: 150,594,404 R11S possibly damaging Het
Notch4 T A 17: 34,565,332 C36* probably null Het
Nwd1 A G 8: 72,671,044 D637G probably damaging Het
Ogfod1 T C 8: 94,055,636 I238T probably benign Het
Palm2 G A 4: 57,688,441 E95K probably damaging Het
Papln A G 12: 83,791,865 D1256G possibly damaging Het
Ppp1r26 T C 2: 28,450,367 L3P probably damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc17a5 A T 9: 78,553,090 probably benign Het
Slc25a17 A G 15: 81,323,706 probably benign Het
Socs4 T C 14: 47,290,655 F349S probably damaging Het
Tchhl1 A C 3: 93,471,571 E527D probably benign Het
Tm7sf3 A G 6: 146,606,289 L425S possibly damaging Het
Tmem266 G T 9: 55,414,955 V112L probably damaging Het
Tmem30c T A 16: 57,270,176 I223F possibly damaging Het
Tomm70a G A 16: 57,122,172 G104D probably benign Het
Ttc17 G T 2: 94,332,803 A834E probably benign Het
Ttn C T 2: 76,731,190 V20664M probably damaging Het
Zbed5 T C 5: 129,902,179 V323A probably benign Het
Other mutations in Casc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Casc3 APN 11 98823202 missense possibly damaging 0.62
IGL01566:Casc3 APN 11 98823401 critical splice donor site probably null
IGL01901:Casc3 APN 11 98823121 missense probably damaging 1.00
IGL02345:Casc3 APN 11 98827564 splice site probably benign
IGL02875:Casc3 APN 11 98821552 missense probably damaging 1.00
IGL02964:Casc3 APN 11 98828923 missense probably damaging 0.96
R0147:Casc3 UTSW 11 98822499 missense possibly damaging 0.89
R0195:Casc3 UTSW 11 98821493 missense probably damaging 0.99
R1581:Casc3 UTSW 11 98822818 missense possibly damaging 0.66
R2021:Casc3 UTSW 11 98821506 missense probably benign 0.01
R4380:Casc3 UTSW 11 98823031 missense possibly damaging 0.67
R4612:Casc3 UTSW 11 98822958 missense probably benign 0.13
R4988:Casc3 UTSW 11 98821874 intron probably null
R5079:Casc3 UTSW 11 98810426 intron probably benign
R5442:Casc3 UTSW 11 98821471 missense probably damaging 0.99
R5511:Casc3 UTSW 11 98810914 nonsense probably null
R5873:Casc3 UTSW 11 98821444 missense unknown
R6041:Casc3 UTSW 11 98828559 missense probably damaging 1.00
R6685:Casc3 UTSW 11 98822530 missense probably damaging 0.99
R7030:Casc3 UTSW 11 98822533 missense possibly damaging 0.74
R7107:Casc3 UTSW 11 98827587 missense possibly damaging 0.93
R7594:Casc3 UTSW 11 98821485 missense probably benign 0.04
R7659:Casc3 UTSW 11 98809873 missense unknown
R7660:Casc3 UTSW 11 98809873 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGCCAGCAATGCCAGGCTTAC -3'
(R):5'- ACACTGAGAGTCACAGTACACTGGG -3'

Sequencing Primer
(F):5'- tttgagacagggagtcactatg -3'
(R):5'- AACTCTTATTAACTGGAACCCCTG -3'
Posted On2013-09-30