Incidental Mutation 'R9627:Kctd19'
ID 725221
Institutional Source Beutler Lab
Gene Symbol Kctd19
Ensembl Gene ENSMUSG00000051648
Gene Name potassium channel tetramerisation domain containing 19
Synonyms 4922504H04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R9627 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 105382807-105413502 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 105387365 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 559 (M559L)
Ref Sequence ENSEMBL: ENSMUSP00000050687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014927] [ENSMUST00000063071] [ENSMUST00000159286] [ENSMUST00000167294] [ENSMUST00000168196]
AlphaFold Q562E2
Predicted Effect probably benign
Transcript: ENSMUST00000014927
SMART Domains Protein: ENSMUSP00000014927
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
low complexity region 364 377 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
RhoGEF 729 900 3.15e-29 SMART
PH 914 1022 1.44e-5 SMART
low complexity region 1148 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063071
AA Change: M559L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000050687
Gene: ENSMUSG00000051648
AA Change: M559L

DomainStartEndE-ValueType
Pfam:BTB_2 15 92 1.3e-9 PFAM
internal_repeat_1 173 251 8.34e-9 PROSPERO
internal_repeat_1 429 509 8.34e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000159286
SMART Domains Protein: ENSMUSP00000125556
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
SCOP:d1aua_2 136 275 5e-9 SMART
Blast:SEC14 137 271 9e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000167294
AA Change: M536L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000130831
Gene: ENSMUSG00000051648
AA Change: M536L

DomainStartEndE-ValueType
Pfam:BTB_2 15 93 3.9e-10 PFAM
internal_repeat_1 173 251 6.24e-9 PROSPERO
internal_repeat_1 406 486 6.24e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000168196
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,657,490 probably benign Het
Abca14 T C 7: 120,255,307 V898A probably benign Het
Adamtsl1 A T 4: 86,388,525 D1400V possibly damaging Het
Akap6 T A 12: 53,104,630 M1159K Het
Atg13 C A 2: 91,678,753 G446* probably null Het
Atp6v1g2 G T 17: 35,235,980 probably null Het
Bmp2k C T 5: 97,053,169 A316V possibly damaging Het
Ccdc34 AAGA AA 2: 110,040,665 probably null Het
Cln6 T A 9: 62,847,021 I115N probably damaging Het
Cma1 T C 14: 55,943,832 T39A probably benign Het
Cpsf1 A T 15: 76,599,888 M744K probably damaging Het
Csf1r A G 18: 61,127,900 Y721C probably damaging Het
Dcaf12 A G 4: 41,293,976 L387P probably benign Het
Ephb1 T C 9: 102,041,269 E347G possibly damaging Het
Fam208a T C 14: 27,472,166 S1108P probably benign Het
Fig4 T A 10: 41,232,182 H674L probably benign Het
Foxa3 T A 7: 19,014,533 K223* probably null Het
Gimap7 T C 6: 48,723,666 V62A probably damaging Het
Glrx3 T A 7: 137,445,026 V49E probably benign Het
Greb1 T C 12: 16,706,166 Y823C probably damaging Het
Hapln4 C A 8: 70,086,870 R184S possibly damaging Het
Hist1h3f G T 13: 23,544,623 V47L possibly damaging Het
Hmcn1 C T 1: 150,630,303 C3824Y probably damaging Het
Hrnr T C 3: 93,325,928 S1158P unknown Het
Itln1 A G 1: 171,533,417 S36P probably benign Het
Kcnh5 A C 12: 75,114,216 I306S probably damaging Het
Kif2a A G 13: 107,022,050 I9T possibly damaging Het
Klra5 G A 6: 129,906,738 T142I probably benign Het
Ldlrad3 A G 2: 101,955,078 V184A probably damaging Het
Lrrc27 T C 7: 139,228,666 probably benign Het
Mark1 A G 1: 184,914,620 V340A probably benign Het
Mrps31 T C 8: 22,411,542 V26A probably benign Het
Mtrr G A 13: 68,577,637 L118F probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nbas G T 12: 13,300,202 V285F possibly damaging Het
Nfrkb T C 9: 31,409,893 L675P possibly damaging Het
Olfr1418 T A 19: 11,855,546 I136F possibly damaging Het
Olfr178 T A 16: 58,889,408 I271L probably benign Het
Olfr357 T A 2: 36,997,653 V281E Het
Phkg1 C T 5: 129,864,535 W358* probably null Het
Plekhj1 A C 10: 80,797,660 I51S possibly damaging Het
Plxnd1 C T 6: 115,963,313 R1370Q possibly damaging Het
Prkg2 T C 5: 98,932,010 *763W probably null Het
Rhobtb2 A G 14: 69,796,900 F292S probably damaging Het
Rlf A T 4: 121,149,805 C769* probably null Het
Rmi1 C A 13: 58,409,552 D538E possibly damaging Het
Scn4a C T 11: 106,322,013 V1389I probably benign Het
Serpinc1 A T 1: 160,993,531 K183* probably null Het
Setd4 A T 16: 93,583,674 M399K possibly damaging Het
Setx T C 2: 29,144,649 M382T probably damaging Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Slfn2 A T 11: 83,069,541 K115N Het
Snrk A T 9: 122,137,361 K117* probably null Het
Spata31 A G 13: 64,917,595 Y38C possibly damaging Het
Stab2 T C 10: 86,957,840 T464A probably damaging Het
Tagap1 C T 17: 6,956,928 G123D probably benign Het
Tas2r136 T C 6: 132,777,985 K60E possibly damaging Het
Tmem200b A C 4: 131,922,126 Y119S probably damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Wdr66 A G 5: 123,322,494 D1173G probably benign Het
Wwp2 T G 8: 107,552,327 L578W probably damaging Het
Zfp53 T A 17: 21,508,483 C259* probably null Het
Other mutations in Kctd19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Kctd19 APN 8 105388463 critical splice donor site probably null
IGL01546:Kctd19 APN 8 105386962 missense probably benign
IGL01786:Kctd19 APN 8 105390304 missense probably benign 0.03
IGL01964:Kctd19 APN 8 105388525 missense probably damaging 0.99
IGL02275:Kctd19 APN 8 105396374 missense probably damaging 0.99
IGL02479:Kctd19 APN 8 105384768 missense probably damaging 1.00
IGL03124:Kctd19 APN 8 105387070 missense possibly damaging 0.48
R0003:Kctd19 UTSW 8 105395361 missense probably damaging 0.99
R1183:Kctd19 UTSW 8 105382966 missense probably benign
R1388:Kctd19 UTSW 8 105392051 missense probably null 0.93
R1491:Kctd19 UTSW 8 105387062 missense possibly damaging 0.60
R1517:Kctd19 UTSW 8 105395376 missense probably damaging 1.00
R1540:Kctd19 UTSW 8 105387879 missense probably damaging 0.96
R1582:Kctd19 UTSW 8 105395460 missense probably damaging 1.00
R1964:Kctd19 UTSW 8 105388470 missense probably damaging 0.98
R1996:Kctd19 UTSW 8 105395300 missense probably null 1.00
R2129:Kctd19 UTSW 8 105385172 missense probably damaging 0.98
R2281:Kctd19 UTSW 8 105387266 missense probably benign 0.00
R3767:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R3768:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R4285:Kctd19 UTSW 8 105382949 unclassified probably benign
R4621:Kctd19 UTSW 8 105396471 missense probably damaging 1.00
R4701:Kctd19 UTSW 8 105390429 missense possibly damaging 0.76
R4969:Kctd19 UTSW 8 105396327 splice site probably null
R5070:Kctd19 UTSW 8 105391999 missense probably damaging 1.00
R5401:Kctd19 UTSW 8 105382985 missense probably benign 0.00
R5582:Kctd19 UTSW 8 105408443 missense probably damaging 1.00
R5783:Kctd19 UTSW 8 105386980 missense probably benign
R6056:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6057:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6269:Kctd19 UTSW 8 105395360 missense possibly damaging 0.96
R6273:Kctd19 UTSW 8 105385485 missense probably benign
R6631:Kctd19 UTSW 8 105385328 critical splice donor site probably null
R7298:Kctd19 UTSW 8 105382984 missense probably benign 0.01
R7474:Kctd19 UTSW 8 105392032 missense probably benign 0.25
R7540:Kctd19 UTSW 8 105386935 missense probably benign 0.00
R7923:Kctd19 UTSW 8 105385058 missense probably damaging 1.00
R8059:Kctd19 UTSW 8 105396351 missense probably benign 0.02
R8117:Kctd19 UTSW 8 105395437 missense unknown
R8836:Kctd19 UTSW 8 105385396 missense probably damaging 0.98
R9155:Kctd19 UTSW 8 105393939 missense probably benign 0.01
R9429:Kctd19 UTSW 8 105383020 missense probably damaging 0.98
R9481:Kctd19 UTSW 8 105393617 missense probably benign 0.00
Z1088:Kctd19 UTSW 8 105385335 missense probably benign 0.02
Z1176:Kctd19 UTSW 8 105385136 missense probably damaging 1.00
Z1177:Kctd19 UTSW 8 105388517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGAGCAGTGTGAGTATGTG -3'
(R):5'- GGCCTGGAGTAACAATCTCTC -3'

Sequencing Primer
(F):5'- ATGTGCTGGGATTGCCTCC -3'
(R):5'- ATATAAAAGTTGCCTGGGCTGG -3'
Posted On 2022-09-12