Incidental Mutation 'R9627:Nfrkb'
ID 725223
Institutional Source Beutler Lab
Gene Symbol Nfrkb
Ensembl Gene ENSMUSG00000042185
Gene Name nuclear factor related to kappa B binding protein
Synonyms A530090G11Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.860) question?
Stock # R9627 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 31386192-31421333 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 31409893 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 675 (L675P)
Ref Sequence ENSEMBL: ENSMUSP00000083341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086167] [ENSMUST00000132329] [ENSMUST00000152593]
AlphaFold Q6PIJ4
Predicted Effect possibly damaging
Transcript: ENSMUST00000086167
AA Change: L675P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000083341
Gene: ENSMUSG00000042185
AA Change: L675P

DomainStartEndE-ValueType
low complexity region 209 234 N/A INTRINSIC
coiled coil region 304 335 N/A INTRINSIC
Pfam:NFRKB_winged 379 478 4.5e-35 PFAM
low complexity region 663 690 N/A INTRINSIC
low complexity region 700 740 N/A INTRINSIC
internal_repeat_1 879 953 2.02e-5 PROSPERO
low complexity region 1016 1034 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
internal_repeat_1 1128 1201 2.02e-5 PROSPERO
low complexity region 1239 1255 N/A INTRINSIC
low complexity region 1269 1290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132329
Predicted Effect probably benign
Transcript: ENSMUST00000152593
SMART Domains Protein: ENSMUSP00000119025
Gene: ENSMUSG00000042185

DomainStartEndE-ValueType
low complexity region 209 234 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,657,490 probably benign Het
Abca14 T C 7: 120,255,307 V898A probably benign Het
Adamtsl1 A T 4: 86,388,525 D1400V possibly damaging Het
Akap6 T A 12: 53,104,630 M1159K Het
Atg13 C A 2: 91,678,753 G446* probably null Het
Atp6v1g2 G T 17: 35,235,980 probably null Het
Bmp2k C T 5: 97,053,169 A316V possibly damaging Het
Ccdc34 AAGA AA 2: 110,040,665 probably null Het
Cln6 T A 9: 62,847,021 I115N probably damaging Het
Cma1 T C 14: 55,943,832 T39A probably benign Het
Cpsf1 A T 15: 76,599,888 M744K probably damaging Het
Csf1r A G 18: 61,127,900 Y721C probably damaging Het
Dcaf12 A G 4: 41,293,976 L387P probably benign Het
Ephb1 T C 9: 102,041,269 E347G possibly damaging Het
Fam208a T C 14: 27,472,166 S1108P probably benign Het
Fig4 T A 10: 41,232,182 H674L probably benign Het
Foxa3 T A 7: 19,014,533 K223* probably null Het
Gimap7 T C 6: 48,723,666 V62A probably damaging Het
Glrx3 T A 7: 137,445,026 V49E probably benign Het
Greb1 T C 12: 16,706,166 Y823C probably damaging Het
Hapln4 C A 8: 70,086,870 R184S possibly damaging Het
Hist1h3f G T 13: 23,544,623 V47L possibly damaging Het
Hmcn1 C T 1: 150,630,303 C3824Y probably damaging Het
Hrnr T C 3: 93,325,928 S1158P unknown Het
Itln1 A G 1: 171,533,417 S36P probably benign Het
Kcnh5 A C 12: 75,114,216 I306S probably damaging Het
Kctd19 T A 8: 105,387,365 M559L probably benign Het
Kif2a A G 13: 107,022,050 I9T possibly damaging Het
Klra5 G A 6: 129,906,738 T142I probably benign Het
Ldlrad3 A G 2: 101,955,078 V184A probably damaging Het
Lrrc27 T C 7: 139,228,666 probably benign Het
Mark1 A G 1: 184,914,620 V340A probably benign Het
Mrps31 T C 8: 22,411,542 V26A probably benign Het
Mtrr G A 13: 68,577,637 L118F probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nbas G T 12: 13,300,202 V285F possibly damaging Het
Olfr1418 T A 19: 11,855,546 I136F possibly damaging Het
Olfr178 T A 16: 58,889,408 I271L probably benign Het
Olfr357 T A 2: 36,997,653 V281E Het
Phkg1 C T 5: 129,864,535 W358* probably null Het
Plekhj1 A C 10: 80,797,660 I51S possibly damaging Het
Plxnd1 C T 6: 115,963,313 R1370Q possibly damaging Het
Prkg2 T C 5: 98,932,010 *763W probably null Het
Rhobtb2 A G 14: 69,796,900 F292S probably damaging Het
Rlf A T 4: 121,149,805 C769* probably null Het
Rmi1 C A 13: 58,409,552 D538E possibly damaging Het
Scn4a C T 11: 106,322,013 V1389I probably benign Het
Serpinc1 A T 1: 160,993,531 K183* probably null Het
Setd4 A T 16: 93,583,674 M399K possibly damaging Het
Setx T C 2: 29,144,649 M382T probably damaging Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Slfn2 A T 11: 83,069,541 K115N Het
Snrk A T 9: 122,137,361 K117* probably null Het
Spata31 A G 13: 64,917,595 Y38C possibly damaging Het
Stab2 T C 10: 86,957,840 T464A probably damaging Het
Tagap1 C T 17: 6,956,928 G123D probably benign Het
Tas2r136 T C 6: 132,777,985 K60E possibly damaging Het
Tmem200b A C 4: 131,922,126 Y119S probably damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Wdr66 A G 5: 123,322,494 D1173G probably benign Het
Wwp2 T G 8: 107,552,327 L578W probably damaging Het
Zfp53 T A 17: 21,508,483 C259* probably null Het
Other mutations in Nfrkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Nfrkb APN 9 31389049 missense probably damaging 0.99
IGL01343:Nfrkb APN 9 31388954 missense probably damaging 0.99
IGL01363:Nfrkb APN 9 31414371 missense possibly damaging 0.53
IGL01647:Nfrkb APN 9 31396505 splice site probably benign
IGL01655:Nfrkb APN 9 31403459 missense probably benign 0.09
IGL01735:Nfrkb APN 9 31410139 missense possibly damaging 0.73
IGL01926:Nfrkb APN 9 31414179 missense probably benign 0.01
IGL01929:Nfrkb APN 9 31419873 missense possibly damaging 0.73
IGL02095:Nfrkb APN 9 31411231 missense probably damaging 0.97
IGL02370:Nfrkb APN 9 31389012 missense probably benign 0.08
IGL02525:Nfrkb APN 9 31414516 missense possibly damaging 0.73
R0325:Nfrkb UTSW 9 31414180 missense probably benign 0.06
R0390:Nfrkb UTSW 9 31388897 start gained probably benign
R0558:Nfrkb UTSW 9 31410268 missense possibly damaging 0.73
R0670:Nfrkb UTSW 9 31420173 missense probably benign 0.33
R1329:Nfrkb UTSW 9 31414647 missense possibly damaging 0.93
R1729:Nfrkb UTSW 9 31414636 missense probably benign 0.00
R1730:Nfrkb UTSW 9 31414636 missense probably benign 0.00
R1894:Nfrkb UTSW 9 31414768 missense probably benign 0.02
R1975:Nfrkb UTSW 9 31414684 missense possibly damaging 0.86
R2022:Nfrkb UTSW 9 31411250 missense probably benign 0.04
R2175:Nfrkb UTSW 9 31389014 missense possibly damaging 0.73
R3793:Nfrkb UTSW 9 31409932 splice site probably benign
R4020:Nfrkb UTSW 9 31414111 missense possibly damaging 0.96
R4425:Nfrkb UTSW 9 31399962 missense probably damaging 0.99
R4727:Nfrkb UTSW 9 31403623 missense probably damaging 0.99
R4730:Nfrkb UTSW 9 31410251 missense probably benign 0.33
R4775:Nfrkb UTSW 9 31419049 missense possibly damaging 0.86
R5032:Nfrkb UTSW 9 31389055 splice site probably null
R5532:Nfrkb UTSW 9 31397779 missense probably damaging 1.00
R5635:Nfrkb UTSW 9 31399298 missense probably damaging 0.98
R5712:Nfrkb UTSW 9 31414636 missense probably benign 0.00
R5720:Nfrkb UTSW 9 31394742 missense probably damaging 1.00
R6448:Nfrkb UTSW 9 31394789 missense probably damaging 1.00
R6543:Nfrkb UTSW 9 31400985 nonsense probably null
R6612:Nfrkb UTSW 9 31397006 nonsense probably null
R7087:Nfrkb UTSW 9 31419932 nonsense probably null
R7123:Nfrkb UTSW 9 31414015 critical splice acceptor site probably null
R7483:Nfrkb UTSW 9 31414032 nonsense probably null
R7875:Nfrkb UTSW 9 31410154 missense possibly damaging 0.53
R8336:Nfrkb UTSW 9 31403519 missense possibly damaging 0.64
R8370:Nfrkb UTSW 9 31405579 missense probably damaging 1.00
R8427:Nfrkb UTSW 9 31419027 missense probably benign 0.01
R8518:Nfrkb UTSW 9 31399965 missense probably damaging 0.99
R9607:Nfrkb UTSW 9 31414770 missense possibly damaging 0.73
R9679:Nfrkb UTSW 9 31410089 missense probably benign
T0975:Nfrkb UTSW 9 31397083 missense probably benign 0.04
Z1088:Nfrkb UTSW 9 31411333 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CCAAGGCCTGGCTTATCTTAC -3'
(R):5'- GAGCCCTCCTTATTACTGGACTTCTAG -3'

Sequencing Primer
(F):5'- CTGGGCTTACAGTTGTGCAAATCAC -3'
(R):5'- CTATGCTACGCTGTCTCA -3'
Posted On 2022-09-12