Incidental Mutation 'R9627:Cma1'
ID 725243
Institutional Source Beutler Lab
Gene Symbol Cma1
Ensembl Gene ENSMUSG00000022225
Gene Name chymase 1, mast cell
Synonyms Mcp-5, MMCP-5, Mcpt5, Mcp5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R9627 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 55941451-55944675 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55943832 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 39 (T39A)
Ref Sequence ENSEMBL: ENSMUSP00000022834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022834] [ENSMUST00000226280]
AlphaFold P21844
Predicted Effect probably benign
Transcript: ENSMUST00000022834
AA Change: T39A

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000022834
Gene: ENSMUSG00000022225
AA Change: T39A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Tryp_SPc 34 253 4.85e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226280
AA Change: T26A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine protease that belongs to the peptidase family S1. It is expressed in mast cells and is thought to function in the degradation of the extracellular matrix, the regulation of submucosal gland secretion, and the generation of vasoactive peptides. The encoded preproprotein undergoes proteolytic processing to generate a functional enzyme with elastase-like activity. Mice lacking the encoded protein exhibit significant attenuation of ischemia-reperfusion injury of the skeletal muscle. This gene is located in a cluster of related mast cell protease genes on chromosome 14. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display a reduction in mast cell-mediated ischemia reperfusion injury of skeletal muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,657,490 probably benign Het
Abca14 T C 7: 120,255,307 V898A probably benign Het
Adamtsl1 A T 4: 86,388,525 D1400V possibly damaging Het
Akap6 T A 12: 53,104,630 M1159K Het
Atg13 C A 2: 91,678,753 G446* probably null Het
Atp6v1g2 G T 17: 35,235,980 probably null Het
Bmp2k C T 5: 97,053,169 A316V possibly damaging Het
Ccdc34 AAGA AA 2: 110,040,665 probably null Het
Cln6 T A 9: 62,847,021 I115N probably damaging Het
Cpsf1 A T 15: 76,599,888 M744K probably damaging Het
Csf1r A G 18: 61,127,900 Y721C probably damaging Het
Dcaf12 A G 4: 41,293,976 L387P probably benign Het
Ephb1 T C 9: 102,041,269 E347G possibly damaging Het
Fam208a T C 14: 27,472,166 S1108P probably benign Het
Fig4 T A 10: 41,232,182 H674L probably benign Het
Foxa3 T A 7: 19,014,533 K223* probably null Het
Gimap7 T C 6: 48,723,666 V62A probably damaging Het
Glrx3 T A 7: 137,445,026 V49E probably benign Het
Greb1 T C 12: 16,706,166 Y823C probably damaging Het
Hapln4 C A 8: 70,086,870 R184S possibly damaging Het
Hist1h3f G T 13: 23,544,623 V47L possibly damaging Het
Hmcn1 C T 1: 150,630,303 C3824Y probably damaging Het
Hrnr T C 3: 93,325,928 S1158P unknown Het
Itln1 A G 1: 171,533,417 S36P probably benign Het
Kcnh5 A C 12: 75,114,216 I306S probably damaging Het
Kctd19 T A 8: 105,387,365 M559L probably benign Het
Kif2a A G 13: 107,022,050 I9T possibly damaging Het
Klra5 G A 6: 129,906,738 T142I probably benign Het
Ldlrad3 A G 2: 101,955,078 V184A probably damaging Het
Lrrc27 T C 7: 139,228,666 probably benign Het
Mark1 A G 1: 184,914,620 V340A probably benign Het
Mrps31 T C 8: 22,411,542 V26A probably benign Het
Mtrr G A 13: 68,577,637 L118F probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nbas G T 12: 13,300,202 V285F possibly damaging Het
Nfrkb T C 9: 31,409,893 L675P possibly damaging Het
Olfr1418 T A 19: 11,855,546 I136F possibly damaging Het
Olfr178 T A 16: 58,889,408 I271L probably benign Het
Olfr357 T A 2: 36,997,653 V281E Het
Phkg1 C T 5: 129,864,535 W358* probably null Het
Plekhj1 A C 10: 80,797,660 I51S possibly damaging Het
Plxnd1 C T 6: 115,963,313 R1370Q possibly damaging Het
Prkg2 T C 5: 98,932,010 *763W probably null Het
Rhobtb2 A G 14: 69,796,900 F292S probably damaging Het
Rlf A T 4: 121,149,805 C769* probably null Het
Rmi1 C A 13: 58,409,552 D538E possibly damaging Het
Scn4a C T 11: 106,322,013 V1389I probably benign Het
Serpinc1 A T 1: 160,993,531 K183* probably null Het
Setd4 A T 16: 93,583,674 M399K possibly damaging Het
Setx T C 2: 29,144,649 M382T probably damaging Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Slfn2 A T 11: 83,069,541 K115N Het
Snrk A T 9: 122,137,361 K117* probably null Het
Spata31 A G 13: 64,917,595 Y38C possibly damaging Het
Stab2 T C 10: 86,957,840 T464A probably damaging Het
Tagap1 C T 17: 6,956,928 G123D probably benign Het
Tas2r136 T C 6: 132,777,985 K60E possibly damaging Het
Tmem200b A C 4: 131,922,126 Y119S probably damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Wdr66 A G 5: 123,322,494 D1173G probably benign Het
Wwp2 T G 8: 107,552,327 L578W probably damaging Het
Zfp53 T A 17: 21,508,483 C259* probably null Het
Other mutations in Cma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Cma1 APN 14 55942697 missense probably benign 0.26
IGL02797:Cma1 APN 14 55943814 missense possibly damaging 0.58
R0026:Cma1 UTSW 14 55942164 missense probably damaging 1.00
R2029:Cma1 UTSW 14 55943734 missense possibly damaging 0.81
R2060:Cma1 UTSW 14 55943698 critical splice donor site probably null
R4994:Cma1 UTSW 14 55941671 missense probably damaging 1.00
R5275:Cma1 UTSW 14 55941700 missense probably damaging 1.00
R5794:Cma1 UTSW 14 55944520 missense probably benign
R5824:Cma1 UTSW 14 55941725 missense possibly damaging 0.79
R5955:Cma1 UTSW 14 55943769 missense probably benign 0.20
R5958:Cma1 UTSW 14 55941656 makesense probably null
R6075:Cma1 UTSW 14 55942314 missense probably damaging 0.97
R6139:Cma1 UTSW 14 55942700 critical splice acceptor site probably null
R7088:Cma1 UTSW 14 55943816 missense probably damaging 1.00
R7139:Cma1 UTSW 14 55943816 missense probably damaging 1.00
R7220:Cma1 UTSW 14 55942663 missense probably benign
R7988:Cma1 UTSW 14 55944532 missense possibly damaging 0.53
R9171:Cma1 UTSW 14 55943732 missense probably benign 0.28
R9803:Cma1 UTSW 14 55941729 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CTTGCATGTGTCCCAGGTTG -3'
(R):5'- CTTGAGAAAGAAGTGACTTTGTGG -3'

Sequencing Primer
(F):5'- GCATGTGTCCCAGGTTGCTATC -3'
(R):5'- AAGTGACTTTGTGGCAGAGG -3'
Posted On 2022-09-12