Incidental Mutation 'R9628:Ly75'
ID 725254
Institutional Source Beutler Lab
Gene Symbol Ly75
Ensembl Gene ENSMUSG00000026980
Gene Name lymphocyte antigen 75
Synonyms DEC-205, CD205
Accession Numbers

Genbank: NM_013825

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9628 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 60292103-60383303 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60327941 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1000 (I1000T)
Ref Sequence ENSEMBL: ENSMUSP00000028362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]
AlphaFold Q60767
Predicted Effect probably damaging
Transcript: ENSMUST00000028362
AA Change: I1000T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980
AA Change: I1000T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112533
AA Change: I1000T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980
AA Change: I1000T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,732,830 N635D probably damaging Het
Ankrd13c G C 3: 157,947,676 K50N probably benign Het
Arhgef38 T C 3: 133,132,264 Y635C unknown Het
Avl9 T A 6: 56,736,475 Y239* probably null Het
C2cd3 T A 7: 100,448,754 H1449Q Het
C530008M17Rik A G 5: 76,857,076 E428G unknown Het
Ccdc141 G A 2: 77,014,494 P1410S probably damaging Het
Ccz1 G A 5: 143,988,225 T471M possibly damaging Het
Cdh26 T C 2: 178,441,420 S27P Het
Cdk11b T G 4: 155,649,697 D756E unknown Het
Celsr3 C A 9: 108,826,360 S14* probably null Het
Cntrob T C 11: 69,322,956 T3A possibly damaging Het
Csde1 T C 3: 103,055,509 V738A probably benign Het
Dazap1 T C 10: 80,283,165 Y230H unknown Het
Dgcr14 A T 16: 17,902,893 M363K probably damaging Het
Dip2a A G 10: 76,307,159 I264T probably damaging Het
Dleu7 C A 14: 62,292,695 A86S possibly damaging Het
Dnmbp T A 19: 43,870,207 D132V probably damaging Het
Dppa4 T C 16: 48,291,309 V219A probably benign Het
Dsg1c T A 18: 20,264,316 I27N probably damaging Het
Egr4 T C 6: 85,512,310 Y256C probably benign Het
Fam124a A G 14: 62,587,561 E168G probably damaging Het
Gata4 T C 14: 63,241,096 Y18C probably damaging Het
Gckr C A 5: 31,300,590 A147D probably damaging Het
H1foo G A 6: 115,947,739 V69I probably damaging Het
Hook1 T C 4: 96,013,323 L506P probably damaging Het
Hormad2 G A 11: 4,427,372 P22L probably damaging Het
Larp1b T C 3: 40,961,668 probably null Het
Ldhb T C 6: 142,494,136 E226G probably damaging Het
Lpar5 T G 6: 125,081,985 V223G probably damaging Het
Lrrc37a A G 11: 103,503,504 V365A probably benign Het
Lrrtm3 T C 10: 64,087,997 K464E probably damaging Het
Myo1d C A 11: 80,557,470 G943V possibly damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nphp4 T C 4: 152,484,509 L35P probably damaging Het
Nptx2 G A 5: 144,553,451 R230H probably benign Het
Ntsr1 G A 2: 180,541,481 R328H probably damaging Het
Olfr1216 A G 2: 89,013,326 V246A probably damaging Het
Olfr384 G A 11: 73,603,038 V153I probably benign Het
Olfr906 T G 9: 38,488,575 L182R probably benign Het
Padi6 G A 4: 140,737,315 T201I probably damaging Het
Plscr4 C T 9: 92,472,932 T13I possibly damaging Het
Ppp6r1 G A 7: 4,633,113 A782V probably benign Het
Rab18 G A 18: 6,788,647 V205M probably benign Het
Rhobtb1 T C 10: 69,270,823 V468A probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Scaf11 A T 15: 96,419,517 I722N probably benign Het
Slc17a4 A G 13: 23,905,529 V135A possibly damaging Het
Slc30a5 A G 13: 100,824,914 probably null Het
Slc5a6 T C 5: 31,040,402 Y321C probably benign Het
Spag7 A T 11: 70,664,360 D178E probably benign Het
Swsap1 T G 9: 21,955,876 S39A Het
Tank A G 2: 61,653,532 T441A probably benign Het
Tor1aip1 C A 1: 156,017,574 G276* probably null Het
Usp47 G A 7: 112,106,792 M1220I probably benign Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r35 A G 7: 7,812,703 V489A probably benign Het
Wif1 T C 10: 121,096,644 V309A possibly damaging Het
Xpo4 T C 14: 57,605,173 N434D probably damaging Het
Zfp462 A T 4: 55,009,423 H463L probably benign Het
Other mutations in Ly75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Ly75 APN 2 60376077 missense probably damaging 1.00
IGL01072:Ly75 APN 2 60354496 missense probably damaging 1.00
IGL01409:Ly75 APN 2 60321692 splice site probably null
IGL01432:Ly75 APN 2 60376007 missense probably damaging 1.00
IGL01626:Ly75 APN 2 60301015 missense probably benign 0.13
IGL01690:Ly75 APN 2 60338311 missense probably damaging 1.00
IGL01862:Ly75 APN 2 60299172 missense probably damaging 1.00
IGL01982:Ly75 APN 2 60311764 missense probably damaging 1.00
IGL02075:Ly75 APN 2 60352356 missense probably damaging 0.99
IGL02338:Ly75 APN 2 60354452 missense probably benign 0.04
IGL02364:Ly75 APN 2 60358507 missense probably damaging 1.00
IGL02456:Ly75 APN 2 60293781 missense probably benign 0.09
IGL02474:Ly75 APN 2 60383182 missense probably null 1.00
IGL02608:Ly75 APN 2 60321900 missense probably benign 0.41
IGL02986:Ly75 APN 2 60308191 missense probably damaging 1.00
IGL03015:Ly75 APN 2 60376160 missense probably damaging 1.00
IGL03049:Ly75 APN 2 60352070 missense probably damaging 0.99
euphues UTSW 2 60299045 critical splice donor site probably null
four_score UTSW 2 60311771 missense possibly damaging 0.75
lyly UTSW 2 60327873 missense possibly damaging 0.49
Witty UTSW 2 60354500 missense probably damaging 1.00
D605:Ly75 UTSW 2 60352352 critical splice donor site probably null
R0046:Ly75 UTSW 2 60339457 intron probably benign
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0285:Ly75 UTSW 2 60318319 missense probably damaging 1.00
R0387:Ly75 UTSW 2 60306404 missense probably benign 0.20
R0492:Ly75 UTSW 2 60308276 missense probably damaging 1.00
R0688:Ly75 UTSW 2 60316221 missense probably benign 0.41
R1367:Ly75 UTSW 2 60293758 splice site probably null
R1463:Ly75 UTSW 2 60368757 critical splice donor site probably null
R1581:Ly75 UTSW 2 60327893 missense probably damaging 1.00
R1663:Ly75 UTSW 2 60314234 missense probably damaging 1.00
R1818:Ly75 UTSW 2 60311777 missense probably damaging 1.00
R1881:Ly75 UTSW 2 60349940 missense probably benign 0.00
R2244:Ly75 UTSW 2 60349913 missense probably benign 0.01
R2905:Ly75 UTSW 2 60334554 missense probably benign 0.00
R3967:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R3968:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R4039:Ly75 UTSW 2 60352995 missense probably damaging 1.00
R4406:Ly75 UTSW 2 60354550 missense probably damaging 1.00
R4526:Ly75 UTSW 2 60330773 missense probably benign 0.09
R4647:Ly75 UTSW 2 60308278 missense probably damaging 1.00
R4795:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4796:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4962:Ly75 UTSW 2 60352125 missense probably damaging 1.00
R4979:Ly75 UTSW 2 60375894 missense probably damaging 1.00
R5072:Ly75 UTSW 2 60375963 missense probably damaging 1.00
R5288:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5373:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5374:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5384:Ly75 UTSW 2 60334487 nonsense probably null
R5385:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5395:Ly75 UTSW 2 60365111 missense probably benign 0.41
R5531:Ly75 UTSW 2 60365145 missense probably damaging 0.98
R5662:Ly75 UTSW 2 60352381 missense probably damaging 1.00
R5667:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5668:Ly75 UTSW 2 60354500 missense probably damaging 1.00
R5671:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5677:Ly75 UTSW 2 60299082 missense probably benign 0.00
R5764:Ly75 UTSW 2 60318439 missense probably benign
R5896:Ly75 UTSW 2 60383146 missense probably benign
R6025:Ly75 UTSW 2 60375962 missense probably damaging 1.00
R6113:Ly75 UTSW 2 60368873 missense probably benign 0.04
R6448:Ly75 UTSW 2 60299045 critical splice donor site probably null
R6601:Ly75 UTSW 2 60318376 missense probably benign 0.11
R6745:Ly75 UTSW 2 60308179 missense probably damaging 1.00
R6955:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R6960:Ly75 UTSW 2 60306405 missense probably benign
R7100:Ly75 UTSW 2 60306434 missense probably benign
R7110:Ly75 UTSW 2 60376184 missense probably benign 0.31
R7203:Ly75 UTSW 2 60323852 nonsense probably null
R7291:Ly75 UTSW 2 60329993 missense probably damaging 0.98
R7308:Ly75 UTSW 2 60334515 missense probably benign 0.04
R7447:Ly75 UTSW 2 60334474 nonsense probably null
R7512:Ly75 UTSW 2 60334563 missense probably damaging 1.00
R7595:Ly75 UTSW 2 60293827 missense probably benign 0.01
R7976:Ly75 UTSW 2 60365088 missense probably damaging 1.00
R8005:Ly75 UTSW 2 60332934 missense probably damaging 1.00
R8171:Ly75 UTSW 2 60314228 missense possibly damaging 0.51
R8392:Ly75 UTSW 2 60349940 missense probably benign 0.00
R8705:Ly75 UTSW 2 60318385 missense probably damaging 0.98
R8714:Ly75 UTSW 2 60334485 missense probably damaging 1.00
R8798:Ly75 UTSW 2 60323926 missense probably benign 0.32
R8799:Ly75 UTSW 2 60348441 missense probably damaging 1.00
R8834:Ly75 UTSW 2 60331089 missense probably benign
R8990:Ly75 UTSW 2 60358559 missense probably benign 0.10
R9015:Ly75 UTSW 2 60316098 missense probably benign
R9547:Ly75 UTSW 2 60330725 critical splice donor site probably null
R9659:Ly75 UTSW 2 60338321 missense probably damaging 1.00
R9660:Ly75 UTSW 2 60323840 missense probably damaging 1.00
R9747:Ly75 UTSW 2 60306328 critical splice donor site probably null
X0025:Ly75 UTSW 2 60354475 missense probably damaging 1.00
Z1177:Ly75 UTSW 2 60350004 nonsense probably null
Z1177:Ly75 UTSW 2 60352133 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- ACGACTCACTCACATTCGTTG -3'
(R):5'- AATCGACTTTCCGTTAGAGAAGG -3'

Sequencing Primer
(F):5'- ACATTCGTTGGTATGCTCAGC -3'
(R):5'- CTTTCCGTTAGAGAAGGCAAAAGGC -3'
Posted On 2022-09-12