Incidental Mutation 'R9628:Myo1d'
ID 725298
Institutional Source Beutler Lab
Gene Symbol Myo1d
Ensembl Gene ENSMUSG00000035441
Gene Name myosin ID
Synonyms D11Ertd9e, 9930104H07Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9628 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 80372952-80670851 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 80448296 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 943 (G943V)
Ref Sequence ENSEMBL: ENSMUSP00000037819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041065]
AlphaFold Q5SYD0
Predicted Effect possibly damaging
Transcript: ENSMUST00000041065
AA Change: G943V

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: G943V

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,553,193 (GRCm39) N635D probably damaging Het
Ankrd13c G C 3: 157,653,313 (GRCm39) K50N probably benign Het
Arhgef38 T C 3: 132,838,025 (GRCm39) Y635C unknown Het
Avl9 T A 6: 56,713,460 (GRCm39) Y239* probably null Het
C2cd3 T A 7: 100,097,961 (GRCm39) H1449Q Het
Ccdc141 G A 2: 76,844,838 (GRCm39) P1410S probably damaging Het
Ccz1 G A 5: 143,925,043 (GRCm39) T471M possibly damaging Het
Cdh26 T C 2: 178,083,213 (GRCm39) S27P Het
Cdk11b T G 4: 155,734,154 (GRCm39) D756E unknown Het
Celsr3 C A 9: 108,703,559 (GRCm39) S14* probably null Het
Cntrob T C 11: 69,213,782 (GRCm39) T3A possibly damaging Het
Cracd A G 5: 77,004,923 (GRCm39) E428G unknown Het
Csde1 T C 3: 102,962,825 (GRCm39) V738A probably benign Het
Dazap1 T C 10: 80,118,999 (GRCm39) Y230H unknown Het
Dip2a A G 10: 76,142,993 (GRCm39) I264T probably damaging Het
Dleu7 C A 14: 62,530,144 (GRCm39) A86S possibly damaging Het
Dnmbp T A 19: 43,858,646 (GRCm39) D132V probably damaging Het
Dppa4 T C 16: 48,111,672 (GRCm39) V219A probably benign Het
Dsg1c T A 18: 20,397,373 (GRCm39) I27N probably damaging Het
Egr4 T C 6: 85,489,292 (GRCm39) Y256C probably benign Het
Ess2 A T 16: 17,720,757 (GRCm39) M363K probably damaging Het
Fam124a A G 14: 62,825,010 (GRCm39) E168G probably damaging Het
Gata4 T C 14: 63,478,545 (GRCm39) Y18C probably damaging Het
Gckr C A 5: 31,457,934 (GRCm39) A147D probably damaging Het
H1f8 G A 6: 115,924,700 (GRCm39) V69I probably damaging Het
Hook1 T C 4: 95,901,560 (GRCm39) L506P probably damaging Het
Hormad2 G A 11: 4,377,372 (GRCm39) P22L probably damaging Het
Larp1b T C 3: 40,916,103 (GRCm39) probably null Het
Ldhb T C 6: 142,439,862 (GRCm39) E226G probably damaging Het
Lpar5 T G 6: 125,058,948 (GRCm39) V223G probably damaging Het
Lrrc37a A G 11: 103,394,330 (GRCm39) V365A probably benign Het
Lrrtm3 T C 10: 63,923,776 (GRCm39) K464E probably damaging Het
Ly75 A G 2: 60,158,285 (GRCm39) I1000T probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nphp4 T C 4: 152,568,966 (GRCm39) L35P probably damaging Het
Nptx2 G A 5: 144,490,261 (GRCm39) R230H probably benign Het
Ntsr1 G A 2: 180,183,274 (GRCm39) R328H probably damaging Het
Or1e25 G A 11: 73,493,864 (GRCm39) V153I probably benign Het
Or4c111 A G 2: 88,843,670 (GRCm39) V246A probably damaging Het
Or8b1 T G 9: 38,399,871 (GRCm39) L182R probably benign Het
Padi6 G A 4: 140,464,626 (GRCm39) T201I probably damaging Het
Plscr4 C T 9: 92,354,985 (GRCm39) T13I possibly damaging Het
Ppp6r1 G A 7: 4,636,112 (GRCm39) A782V probably benign Het
Rab18 G A 18: 6,788,647 (GRCm39) V205M probably benign Het
Rhobtb1 T C 10: 69,106,653 (GRCm39) V468A probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 36,966,991 (GRCm39) probably benign Het
Scaf11 A T 15: 96,317,398 (GRCm39) I722N probably benign Het
Slc17a4 A G 13: 24,089,512 (GRCm39) V135A possibly damaging Het
Slc30a5 A G 13: 100,961,422 (GRCm39) probably null Het
Slc5a6 T C 5: 31,197,746 (GRCm39) Y321C probably benign Het
Spag7 A T 11: 70,555,186 (GRCm39) D178E probably benign Het
Swsap1 T G 9: 21,867,172 (GRCm39) S39A Het
Tank A G 2: 61,483,876 (GRCm39) T441A probably benign Het
Tor1aip1 C A 1: 155,893,320 (GRCm39) G276* probably null Het
Usp47 G A 7: 111,705,999 (GRCm39) M1220I probably benign Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Vmn2r35 A G 7: 7,815,702 (GRCm39) V489A probably benign Het
Wif1 T C 10: 120,932,549 (GRCm39) V309A possibly damaging Het
Xpo4 T C 14: 57,842,630 (GRCm39) N434D probably damaging Het
Zfp462 A T 4: 55,009,423 (GRCm39) H463L probably benign Het
Other mutations in Myo1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80,492,566 (GRCm39) missense probably benign
IGL01087:Myo1d APN 11 80,573,261 (GRCm39) missense probably damaging 1.00
IGL01326:Myo1d APN 11 80,575,147 (GRCm39) splice site probably benign
IGL01431:Myo1d APN 11 80,565,665 (GRCm39) missense probably damaging 1.00
IGL01595:Myo1d APN 11 80,566,936 (GRCm39) missense probably benign 0.00
IGL01811:Myo1d APN 11 80,583,823 (GRCm39) missense probably damaging 0.96
IGL02301:Myo1d APN 11 80,567,679 (GRCm39) missense probably benign 0.23
IGL02388:Myo1d APN 11 80,528,823 (GRCm39) nonsense probably null
IGL02485:Myo1d APN 11 80,557,407 (GRCm39) missense probably damaging 1.00
IGL03017:Myo1d APN 11 80,492,452 (GRCm39) missense probably benign 0.26
horton UTSW 11 80,565,534 (GRCm39) missense probably damaging 1.00
multifaceted UTSW 11 80,583,898 (GRCm39) missense probably damaging 1.00
whisper UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
whisper2 UTSW 11 80,557,404 (GRCm39) missense probably damaging 1.00
whisper3 UTSW 11 80,448,347 (GRCm39) missense probably damaging 1.00
R0069:Myo1d UTSW 11 80,528,779 (GRCm39) missense probably damaging 1.00
R0069:Myo1d UTSW 11 80,528,779 (GRCm39) missense probably damaging 1.00
R0081:Myo1d UTSW 11 80,448,349 (GRCm39) missense probably benign 0.00
R0096:Myo1d UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
R0096:Myo1d UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
R0244:Myo1d UTSW 11 80,565,534 (GRCm39) missense probably damaging 1.00
R0711:Myo1d UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
R0746:Myo1d UTSW 11 80,477,705 (GRCm39) missense possibly damaging 0.94
R1084:Myo1d UTSW 11 80,575,221 (GRCm39) missense probably damaging 1.00
R1514:Myo1d UTSW 11 80,576,734 (GRCm39) missense probably damaging 0.97
R1676:Myo1d UTSW 11 80,575,247 (GRCm39) missense probably damaging 1.00
R1862:Myo1d UTSW 11 80,553,874 (GRCm39) missense probably damaging 1.00
R2497:Myo1d UTSW 11 80,565,647 (GRCm39) missense probably damaging 1.00
R2512:Myo1d UTSW 11 80,670,543 (GRCm39) missense probably benign 0.00
R3425:Myo1d UTSW 11 80,492,464 (GRCm39) missense probably benign
R3429:Myo1d UTSW 11 80,573,236 (GRCm39) missense probably damaging 1.00
R3917:Myo1d UTSW 11 80,557,404 (GRCm39) missense probably damaging 1.00
R3928:Myo1d UTSW 11 80,375,087 (GRCm39) missense probably benign 0.09
R4706:Myo1d UTSW 11 80,557,467 (GRCm39) missense probably damaging 0.96
R4723:Myo1d UTSW 11 80,670,667 (GRCm39) utr 5 prime probably benign
R4924:Myo1d UTSW 11 80,565,504 (GRCm39) missense probably damaging 1.00
R5042:Myo1d UTSW 11 80,448,347 (GRCm39) missense probably damaging 1.00
R5320:Myo1d UTSW 11 80,575,149 (GRCm39) critical splice donor site probably null
R5481:Myo1d UTSW 11 80,553,921 (GRCm39) missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80,670,617 (GRCm39) start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80,583,770 (GRCm39) missense probably benign 0.23
R6282:Myo1d UTSW 11 80,448,338 (GRCm39) missense probably damaging 0.99
R6468:Myo1d UTSW 11 80,448,300 (GRCm39) missense probably benign 0.00
R6668:Myo1d UTSW 11 80,474,701 (GRCm39) intron probably benign
R6954:Myo1d UTSW 11 80,565,783 (GRCm39) missense probably benign 0.21
R7077:Myo1d UTSW 11 80,565,460 (GRCm39) missense probably damaging 1.00
R7078:Myo1d UTSW 11 80,565,460 (GRCm39) missense probably damaging 1.00
R7080:Myo1d UTSW 11 80,565,460 (GRCm39) missense probably damaging 1.00
R7172:Myo1d UTSW 11 80,483,621 (GRCm39) missense probably benign 0.16
R7276:Myo1d UTSW 11 80,583,898 (GRCm39) missense probably damaging 1.00
R7467:Myo1d UTSW 11 80,477,743 (GRCm39) missense probably damaging 1.00
R7650:Myo1d UTSW 11 80,492,510 (GRCm39) missense probably benign
R7678:Myo1d UTSW 11 80,567,719 (GRCm39) missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80,575,203 (GRCm39) missense probably damaging 1.00
R8324:Myo1d UTSW 11 80,448,347 (GRCm39) missense probably damaging 1.00
R8329:Myo1d UTSW 11 80,528,900 (GRCm39) missense probably benign 0.21
R8474:Myo1d UTSW 11 80,561,745 (GRCm39) missense possibly damaging 0.93
R8799:Myo1d UTSW 11 80,575,205 (GRCm39) missense probably damaging 1.00
R8810:Myo1d UTSW 11 80,567,758 (GRCm39) missense probably benign 0.30
R8810:Myo1d UTSW 11 80,565,758 (GRCm39) missense probably damaging 1.00
R8823:Myo1d UTSW 11 80,492,571 (GRCm39) missense possibly damaging 0.91
R9221:Myo1d UTSW 11 80,565,744 (GRCm39) missense probably damaging 1.00
R9494:Myo1d UTSW 11 80,375,093 (GRCm39) missense probably benign 0.02
R9625:Myo1d UTSW 11 80,448,296 (GRCm39) missense possibly damaging 0.95
R9626:Myo1d UTSW 11 80,448,296 (GRCm39) missense possibly damaging 0.95
Z1088:Myo1d UTSW 11 80,565,724 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCGGATGCTAATTTCACCTTC -3'
(R):5'- ATCGTCACCATCGTTGCTATG -3'

Sequencing Primer
(F):5'- GCACAAACCAAGGTTAGTG -3'
(R):5'- ACCATCGTTGCTATGGCCTG -3'
Posted On 2022-09-12