Incidental Mutation 'R9628:Dnmbp'
ID 725312
Institutional Source Beutler Lab
Gene Symbol Dnmbp
Ensembl Gene ENSMUSG00000025195
Gene Name dynamin binding protein
Synonyms 2410003M15Rik, 2410003L07Rik, Tuba
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9628 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 43846821-43940191 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43870207 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 132 (D132V)
Ref Sequence ENSEMBL: ENSMUSP00000148421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026209] [ENSMUST00000212032] [ENSMUST00000212048] [ENSMUST00000212396] [ENSMUST00000212592]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026209
AA Change: D895V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026209
Gene: ENSMUSG00000025195
AA Change: D895V

DomainStartEndE-ValueType
SH3 5 60 6.75e-14 SMART
SH3 69 126 3.33e-4 SMART
SH3 149 204 6.85e-15 SMART
SH3 247 302 8.43e-15 SMART
low complexity region 601 619 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
coiled coil region 694 755 N/A INTRINSIC
low complexity region 756 764 N/A INTRINSIC
RhoGEF 787 969 4.84e-39 SMART
BAR 999 1213 6.21e-55 SMART
SH3 1291 1350 4.62e-1 SMART
low complexity region 1354 1374 N/A INTRINSIC
SH3 1519 1578 1.08e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212032
AA Change: D885V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212048
AA Change: D573V

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably damaging
Transcript: ENSMUST00000212396
AA Change: D895V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212592
AA Change: D132V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the DBL family of guanine nucleotide exchange factors. The encoded protein has been proposed to regulate the actin cytoskeleton by specifically activating the Rho-family GTPase Cdc42. An interaction between the encoded protein and a Listeria protein has been shown to mediate Listeria infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,732,830 N635D probably damaging Het
Ankrd13c G C 3: 157,947,676 K50N probably benign Het
Arhgef38 T C 3: 133,132,264 Y635C unknown Het
Avl9 T A 6: 56,736,475 Y239* probably null Het
C2cd3 T A 7: 100,448,754 H1449Q Het
C530008M17Rik A G 5: 76,857,076 E428G unknown Het
Ccdc141 G A 2: 77,014,494 P1410S probably damaging Het
Ccz1 G A 5: 143,988,225 T471M possibly damaging Het
Cdh26 T C 2: 178,441,420 S27P Het
Cdk11b T G 4: 155,649,697 D756E unknown Het
Celsr3 C A 9: 108,826,360 S14* probably null Het
Cntrob T C 11: 69,322,956 T3A possibly damaging Het
Csde1 T C 3: 103,055,509 V738A probably benign Het
Dazap1 T C 10: 80,283,165 Y230H unknown Het
Dgcr14 A T 16: 17,902,893 M363K probably damaging Het
Dip2a A G 10: 76,307,159 I264T probably damaging Het
Dleu7 C A 14: 62,292,695 A86S possibly damaging Het
Dppa4 T C 16: 48,291,309 V219A probably benign Het
Dsg1c T A 18: 20,264,316 I27N probably damaging Het
Egr4 T C 6: 85,512,310 Y256C probably benign Het
Fam124a A G 14: 62,587,561 E168G probably damaging Het
Gata4 T C 14: 63,241,096 Y18C probably damaging Het
Gckr C A 5: 31,300,590 A147D probably damaging Het
H1foo G A 6: 115,947,739 V69I probably damaging Het
Hook1 T C 4: 96,013,323 L506P probably damaging Het
Hormad2 G A 11: 4,427,372 P22L probably damaging Het
Larp1b T C 3: 40,961,668 probably null Het
Ldhb T C 6: 142,494,136 E226G probably damaging Het
Lpar5 T G 6: 125,081,985 V223G probably damaging Het
Lrrc37a A G 11: 103,503,504 V365A probably benign Het
Lrrtm3 T C 10: 64,087,997 K464E probably damaging Het
Ly75 A G 2: 60,327,941 I1000T probably damaging Het
Myo1d C A 11: 80,557,470 G943V possibly damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nphp4 T C 4: 152,484,509 L35P probably damaging Het
Nptx2 G A 5: 144,553,451 R230H probably benign Het
Ntsr1 G A 2: 180,541,481 R328H probably damaging Het
Olfr1216 A G 2: 89,013,326 V246A probably damaging Het
Olfr384 G A 11: 73,603,038 V153I probably benign Het
Olfr906 T G 9: 38,488,575 L182R probably benign Het
Padi6 G A 4: 140,737,315 T201I probably damaging Het
Plscr4 C T 9: 92,472,932 T13I possibly damaging Het
Ppp6r1 G A 7: 4,633,113 A782V probably benign Het
Rab18 G A 18: 6,788,647 V205M probably benign Het
Rhobtb1 T C 10: 69,270,823 V468A probably damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Scaf11 A T 15: 96,419,517 I722N probably benign Het
Slc17a4 A G 13: 23,905,529 V135A possibly damaging Het
Slc30a5 A G 13: 100,824,914 probably null Het
Slc5a6 T C 5: 31,040,402 Y321C probably benign Het
Spag7 A T 11: 70,664,360 D178E probably benign Het
Swsap1 T G 9: 21,955,876 S39A Het
Tank A G 2: 61,653,532 T441A probably benign Het
Tor1aip1 C A 1: 156,017,574 G276* probably null Het
Usp47 G A 7: 112,106,792 M1220I probably benign Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r35 A G 7: 7,812,703 V489A probably benign Het
Wif1 T C 10: 121,096,644 V309A possibly damaging Het
Xpo4 T C 14: 57,605,173 N434D probably damaging Het
Zfp462 A T 4: 55,009,423 H463L probably benign Het
Other mutations in Dnmbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Dnmbp APN 19 43902479 missense probably damaging 1.00
IGL01301:Dnmbp APN 19 43902354 missense probably benign 0.04
IGL01443:Dnmbp APN 19 43902870 missense probably damaging 1.00
IGL01569:Dnmbp APN 19 43874856 missense probably benign 0.14
IGL01818:Dnmbp APN 19 43901165 missense probably damaging 1.00
IGL01989:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02111:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02666:Dnmbp APN 19 43854127 splice site probably benign
IGL02736:Dnmbp APN 19 43849770 splice site probably benign
ANU18:Dnmbp UTSW 19 43902354 missense probably benign 0.04
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0101:Dnmbp UTSW 19 43874160 missense possibly damaging 0.94
R0129:Dnmbp UTSW 19 43850027 missense probably benign 0.03
R0288:Dnmbp UTSW 19 43902459 missense possibly damaging 0.77
R0322:Dnmbp UTSW 19 43854846 missense probably damaging 1.00
R0426:Dnmbp UTSW 19 43852436 splice site probably benign
R0432:Dnmbp UTSW 19 43854857 nonsense probably null
R0497:Dnmbp UTSW 19 43856640 splice site probably benign
R1306:Dnmbp UTSW 19 43901779 missense probably benign 0.00
R1765:Dnmbp UTSW 19 43902140 missense possibly damaging 0.61
R1800:Dnmbp UTSW 19 43901720 missense probably benign 0.00
R1846:Dnmbp UTSW 19 43902747 missense probably damaging 1.00
R1916:Dnmbp UTSW 19 43901568 missense possibly damaging 0.85
R2001:Dnmbp UTSW 19 43850173 missense possibly damaging 0.76
R2131:Dnmbp UTSW 19 43854311 missense probably damaging 1.00
R2156:Dnmbp UTSW 19 43901907 missense possibly damaging 0.95
R2238:Dnmbp UTSW 19 43868864 missense possibly damaging 0.90
R2372:Dnmbp UTSW 19 43902320 missense probably benign 0.01
R4817:Dnmbp UTSW 19 43849972 missense probably benign 0.05
R5093:Dnmbp UTSW 19 43849876 missense probably damaging 0.98
R5249:Dnmbp UTSW 19 43902440 missense probably damaging 0.98
R5970:Dnmbp UTSW 19 43854171 missense probably benign 0.28
R6168:Dnmbp UTSW 19 43850240 missense probably damaging 1.00
R6189:Dnmbp UTSW 19 43890309 missense probably benign 0.00
R6189:Dnmbp UTSW 19 43901511 missense probably benign 0.05
R6239:Dnmbp UTSW 19 43848185 missense probably benign 0.11
R6256:Dnmbp UTSW 19 43852281 missense probably damaging 1.00
R6461:Dnmbp UTSW 19 43867525 critical splice donor site probably null
R6599:Dnmbp UTSW 19 43856586 missense probably damaging 0.96
R6704:Dnmbp UTSW 19 43901213 missense probably damaging 1.00
R7350:Dnmbp UTSW 19 43901505 missense probably damaging 1.00
R7355:Dnmbp UTSW 19 43901741 missense probably benign
R7409:Dnmbp UTSW 19 43890557 missense unknown
R7548:Dnmbp UTSW 19 43889399 missense probably benign 0.40
R7755:Dnmbp UTSW 19 43850086 missense probably benign
R7814:Dnmbp UTSW 19 43854176 missense probably benign 0.05
R7954:Dnmbp UTSW 19 43902303 missense probably benign
R7955:Dnmbp UTSW 19 43902323 missense probably benign 0.01
R8282:Dnmbp UTSW 19 43890566 missense unknown
R8385:Dnmbp UTSW 19 43889651 missense probably benign 0.01
R8696:Dnmbp UTSW 19 43874223 missense probably damaging 1.00
R8738:Dnmbp UTSW 19 43912238 missense probably damaging 0.98
R8819:Dnmbp UTSW 19 43901415 missense probably benign 0.43
R8824:Dnmbp UTSW 19 43849837 missense probably benign
R8902:Dnmbp UTSW 19 43901786 missense probably benign 0.00
R8906:Dnmbp UTSW 19 43890242 missense probably benign 0.01
R8977:Dnmbp UTSW 19 43852312 missense probably damaging 1.00
R9635:Dnmbp UTSW 19 43867535 missense probably benign 0.39
R9771:Dnmbp UTSW 19 43866592 missense probably damaging 0.96
Z1088:Dnmbp UTSW 19 43874984 missense probably benign 0.01
Z1088:Dnmbp UTSW 19 43902122 missense probably benign 0.00
Z1176:Dnmbp UTSW 19 43866688 missense probably damaging 0.99
Z1176:Dnmbp UTSW 19 43889367 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GGACACAATTGGGAAGTCACC -3'
(R):5'- TCAGACTTGAATGGCCATACC -3'

Sequencing Primer
(F):5'- CAATTGGGAAGTCACCTAAGATTTC -3'
(R):5'- GGCCATACCATTTGTTGATATACTC -3'
Posted On 2022-09-12