Incidental Mutation 'R9629:Dock10'
ID 725317
Institutional Source Beutler Lab
Gene Symbol Dock10
Ensembl Gene ENSMUSG00000038608
Gene Name dedicator of cytokinesis 10
Synonyms Zizimin3, A630054M16Rik, Jr5, ZIZ3, Jr4, 9330153B10Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.487) question?
Stock # R9629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 80478790-80736244 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80481389 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 536 (I536K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077946] [ENSMUST00000187774] [ENSMUST00000190595] [ENSMUST00000190983]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000077946
SMART Domains Protein: ENSMUSP00000077099
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
Pfam:DUF3398 61 153 1.7e-36 PFAM
PH 182 292 8.5e-17 SMART
Blast:PH 350 458 7e-18 BLAST
Pfam:DOCK-C2 668 859 1e-50 PFAM
low complexity region 1269 1279 N/A INTRINSIC
low complexity region 1284 1295 N/A INTRINSIC
Pfam:DHR-2 1592 2143 1.3e-216 PFAM
low complexity region 2174 2187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187774
SMART Domains Protein: ENSMUSP00000140085
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
Pfam:DUF3398 46 141 9e-29 PFAM
PH 170 280 3.9e-19 SMART
Blast:PH 338 446 7e-18 BLAST
Pfam:DOCK-C2 655 848 1.5e-54 PFAM
low complexity region 1257 1267 N/A INTRINSIC
low complexity region 1272 1283 N/A INTRINSIC
low complexity region 1870 1890 N/A INTRINSIC
Pfam:Ded_cyto 1954 2131 3.4e-65 PFAM
low complexity region 2162 2175 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000190595
SMART Domains Protein: ENSMUSP00000139567
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
Blast:PH 3 111 5e-18 BLAST
Pfam:DOCK-C2 320 513 1.2e-54 PFAM
low complexity region 922 932 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
Pfam:Ded_cyto 1588 1765 2.7e-65 PFAM
low complexity region 1783 1795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190983
SMART Domains Protein: ENSMUSP00000140719
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
Pfam:DUF3398 45 140 8.9e-29 PFAM
PH 169 279 3.9e-19 SMART
Blast:PH 337 445 7e-18 BLAST
Pfam:DOCK-C2 654 847 1.5e-54 PFAM
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1271 1282 N/A INTRINSIC
low complexity region 1869 1889 N/A INTRINSIC
Pfam:Ded_cyto 1953 2130 3.4e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family are guanosine nucleotide exchange factors for Rho GTPases and defined by the presence of conserved DOCK-homology regions. The encoded protein belongs to the D (or Zizimin) subfamily of DOCK proteins, which also contain an N-terminal pleckstrin homology domain. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction of B cell numbers in secondary lymphoid organs. Follicular B cells show membrane CD23 overexpression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,532,134 (GRCm39) E147G probably damaging Het
Agrn G A 4: 156,257,094 (GRCm39) Q1217* probably null Het
Ankrd13c G C 3: 157,653,313 (GRCm39) K50N probably benign Het
Anks3 C T 16: 4,775,565 (GRCm39) S144N probably damaging Het
Apob A T 12: 8,059,054 (GRCm39) D2512V probably damaging Het
Arhgap45 A G 10: 79,863,694 (GRCm39) K815E probably damaging Het
Atr T A 9: 95,747,098 (GRCm39) C127S probably benign Het
B4galnt4 A G 7: 140,648,575 (GRCm39) D697G probably damaging Het
C2cd3 C T 7: 100,029,249 (GRCm39) L134F probably damaging Het
Celsr2 C T 3: 108,308,915 (GRCm39) G1697D probably damaging Het
Cep170 A G 1: 176,583,821 (GRCm39) S88P possibly damaging Het
Cnot1 A G 8: 96,455,874 (GRCm39) V1961A probably damaging Het
Cntnap4 A G 8: 113,568,349 (GRCm39) N795S probably damaging Het
Cog2 T A 8: 125,260,125 (GRCm39) V256D possibly damaging Het
Col14a1 A G 15: 55,382,545 (GRCm39) Y515C Het
Cox7a1 A G 7: 29,884,583 (GRCm39) Q30R probably damaging Het
Cs T C 10: 128,196,885 (GRCm39) S427P probably damaging Het
Dbr1 T A 9: 99,464,523 (GRCm39) C101S Het
Dhcr7 C A 7: 143,401,212 (GRCm39) Y461* probably null Het
Dis3l2 T A 1: 86,974,784 (GRCm39) M691K probably benign Het
Dnah17 T C 11: 117,979,804 (GRCm39) D1751G probably damaging Het
Dok6 G T 18: 89,491,988 (GRCm39) F196L possibly damaging Het
Epx C T 11: 87,755,651 (GRCm39) D678N probably damaging Het
Fcrlb G C 1: 170,739,735 (GRCm39) P56A probably benign Het
Flrt3 T C 2: 140,502,816 (GRCm39) R271G possibly damaging Het
Galnt15 T A 14: 31,774,301 (GRCm39) L479Q probably damaging Het
Gfy G A 7: 44,827,785 (GRCm39) L104F probably benign Het
Gltp C T 5: 114,814,382 (GRCm39) M80I probably benign Het
Gm21560 G A 14: 6,218,250 (GRCm38) T76I probably benign Het
Gm5150 A G 3: 16,044,829 (GRCm39) I132T probably benign Het
Hdac9 T C 12: 34,439,389 (GRCm39) H437R probably damaging Het
Hpgd C A 8: 56,751,419 (GRCm39) F82L Het
Ifi207 GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT 1: 173,556,561 (GRCm39) probably benign Het
Ilrun A T 17: 28,012,913 (GRCm39) F95I probably damaging Het
Itgb5 C T 16: 33,696,295 (GRCm39) T162I probably damaging Het
Jakmip3 G A 7: 138,625,118 (GRCm39) probably null Het
Kctd1 A T 18: 15,196,611 (GRCm39) M4K unknown Het
Kirrel1 C A 3: 87,003,025 (GRCm39) E123* probably null Het
Krt87 G C 15: 101,389,048 (GRCm39) P95A probably benign Het
Man1a A T 10: 53,796,158 (GRCm39) H511Q probably damaging Het
Megf8 A G 7: 25,043,194 (GRCm39) D1372G possibly damaging Het
Mrgprd A G 7: 144,875,189 (GRCm39) D20G probably benign Het
Mrpl54 C T 10: 81,101,528 (GRCm39) G78S probably damaging Het
Myl1 T A 1: 66,969,448 (GRCm39) E61D probably benign Het
Myo7a G T 7: 97,712,937 (GRCm39) H1679Q probably benign Het
Naca A G 10: 127,878,226 (GRCm39) E1086G unknown Het
Nagpa C G 16: 5,017,829 (GRCm39) D258H probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nr2f6 G A 8: 71,827,171 (GRCm39) L377F probably damaging Het
Ntsr1 G A 2: 180,183,274 (GRCm39) R328H probably damaging Het
Nup93 G A 8: 95,033,267 (GRCm39) S592N probably damaging Het
Or10a2 A T 7: 106,673,164 (GRCm39) N43I probably damaging Het
Or4k40 T A 2: 111,251,137 (GRCm39) H53L probably benign Het
Or8g36 T C 9: 39,422,497 (GRCm39) D173G probably benign Het
Pard3 T C 8: 128,136,153 (GRCm39) V842A possibly damaging Het
Phospho2 T A 2: 69,626,295 (GRCm39) N150K probably damaging Het
Piwil1 T C 5: 128,831,051 (GRCm39) S791P probably damaging Het
Pkhd1 A G 1: 20,462,437 (GRCm39) V2039A possibly damaging Het
Ppp1r3c A G 19: 36,711,404 (GRCm39) I122T probably benign Het
Prrc2c A G 1: 162,519,959 (GRCm39) Y2131H possibly damaging Het
Qtrt2 T C 16: 43,683,540 (GRCm39) M311V possibly damaging Het
Rbbp4 T C 4: 129,212,243 (GRCm39) D346G probably damaging Het
Slc13a5 A G 11: 72,138,578 (GRCm39) I455T probably damaging Het
Slc28a3 A T 13: 58,717,187 (GRCm39) Y366* probably null Het
Srgap1 T A 10: 121,705,746 (GRCm39) Q226L probably benign Het
Syt17 A G 7: 118,007,379 (GRCm39) V362A probably damaging Het
Tas2r117 T C 6: 132,780,374 (GRCm39) S171P probably benign Het
Tfap2b A T 1: 19,289,468 (GRCm39) I198F probably damaging Het
Tg A T 15: 66,555,587 (GRCm39) I760F possibly damaging Het
Tmem123 T C 9: 7,790,984 (GRCm39) V95A possibly damaging Het
Tmem198b C A 10: 128,638,386 (GRCm39) G59V probably damaging Het
Tmem30c T G 16: 57,096,585 (GRCm39) I179L probably benign Het
Tmprss2 A T 16: 97,369,702 (GRCm39) D357E probably benign Het
Tns3 G A 11: 8,401,142 (GRCm39) T1052M possibly damaging Het
Trex1 A T 9: 108,887,632 (GRCm39) C120S probably damaging Het
Ttc8 A G 12: 98,886,965 (GRCm39) S13G possibly damaging Het
Ttll7 T C 3: 146,621,487 (GRCm39) I362T probably damaging Het
Usp34 A T 11: 23,314,364 (GRCm39) T769S Het
Vmn1r185 G T 7: 26,311,439 (GRCm39) T22K probably damaging Het
Vmn1r39 T G 6: 66,781,578 (GRCm39) M247L probably benign Het
Vmn2r96 A G 17: 18,803,257 (GRCm39) D389G probably benign Het
Xirp1 C T 9: 119,846,379 (GRCm39) V835I probably benign Het
Ylpm1 T G 12: 85,044,036 (GRCm39) I258S unknown Het
Zfp971 A T 2: 177,675,417 (GRCm39) S339C probably damaging Het
Other mutations in Dock10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dock10 APN 1 80,562,729 (GRCm39) missense probably damaging 1.00
IGL00783:Dock10 APN 1 80,550,166 (GRCm39) splice site probably benign
IGL00784:Dock10 APN 1 80,550,166 (GRCm39) splice site probably benign
IGL00858:Dock10 APN 1 80,545,720 (GRCm39) missense possibly damaging 0.48
IGL01298:Dock10 APN 1 80,508,962 (GRCm39) missense probably damaging 1.00
IGL01351:Dock10 APN 1 80,570,876 (GRCm39) missense probably damaging 1.00
IGL01356:Dock10 APN 1 80,501,459 (GRCm39) missense probably damaging 1.00
IGL01584:Dock10 APN 1 80,511,567 (GRCm39) missense probably damaging 0.99
IGL01619:Dock10 APN 1 80,612,015 (GRCm39) splice site probably benign
IGL01678:Dock10 APN 1 80,521,069 (GRCm39) missense probably damaging 1.00
IGL01759:Dock10 APN 1 80,503,990 (GRCm39) missense probably damaging 1.00
IGL02238:Dock10 APN 1 80,511,510 (GRCm39) missense probably damaging 0.99
IGL02352:Dock10 APN 1 80,483,378 (GRCm39) missense probably damaging 1.00
IGL02359:Dock10 APN 1 80,483,378 (GRCm39) missense probably damaging 1.00
IGL02377:Dock10 APN 1 80,562,711 (GRCm39) critical splice donor site probably null
IGL02433:Dock10 APN 1 80,507,905 (GRCm39) missense probably damaging 1.00
IGL02471:Dock10 APN 1 80,493,339 (GRCm39) missense probably damaging 0.99
IGL02645:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02646:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02648:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02649:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02650:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02652:Dock10 APN 1 80,570,561 (GRCm39) splice site probably null
IGL02718:Dock10 APN 1 80,501,535 (GRCm39) missense probably benign 0.00
IGL02998:Dock10 APN 1 80,551,259 (GRCm39) missense probably damaging 1.00
IGL03057:Dock10 APN 1 80,545,088 (GRCm39) missense probably damaging 1.00
IGL03066:Dock10 APN 1 80,562,758 (GRCm39) missense probably benign 0.00
IGL03106:Dock10 APN 1 80,546,551 (GRCm39) missense probably damaging 0.98
IGL03148:Dock10 APN 1 80,518,075 (GRCm39) missense probably benign 0.01
IGL03271:Dock10 APN 1 80,483,126 (GRCm39) missense probably damaging 1.00
IGL03352:Dock10 APN 1 80,584,013 (GRCm39) splice site probably benign
LCD18:Dock10 UTSW 1 80,716,623 (GRCm38) intron probably benign
PIT4366001:Dock10 UTSW 1 80,573,438 (GRCm39) missense probably benign 0.30
PIT4581001:Dock10 UTSW 1 80,483,163 (GRCm39) missense probably damaging 1.00
R0019:Dock10 UTSW 1 80,583,642 (GRCm39) missense probably damaging 1.00
R0081:Dock10 UTSW 1 80,584,295 (GRCm39) missense probably damaging 0.99
R0095:Dock10 UTSW 1 80,501,788 (GRCm39) missense probably benign 0.00
R0241:Dock10 UTSW 1 80,556,340 (GRCm39) missense probably benign
R0241:Dock10 UTSW 1 80,556,340 (GRCm39) missense probably benign
R0255:Dock10 UTSW 1 80,583,593 (GRCm39) missense probably damaging 1.00
R0267:Dock10 UTSW 1 80,490,171 (GRCm39) missense probably damaging 1.00
R0299:Dock10 UTSW 1 80,514,646 (GRCm39) missense probably damaging 0.99
R0365:Dock10 UTSW 1 80,573,400 (GRCm39) missense probably damaging 1.00
R0387:Dock10 UTSW 1 80,517,993 (GRCm39) missense probably damaging 1.00
R0403:Dock10 UTSW 1 80,501,787 (GRCm39) missense possibly damaging 0.94
R0408:Dock10 UTSW 1 80,518,193 (GRCm39) missense probably benign 0.03
R0414:Dock10 UTSW 1 80,513,650 (GRCm39) missense possibly damaging 0.93
R0591:Dock10 UTSW 1 80,518,936 (GRCm39) splice site probably benign
R0698:Dock10 UTSW 1 80,507,895 (GRCm39) missense probably damaging 1.00
R0711:Dock10 UTSW 1 80,501,692 (GRCm39) missense probably damaging 1.00
R0925:Dock10 UTSW 1 80,514,657 (GRCm39) missense probably benign 0.20
R1162:Dock10 UTSW 1 80,546,559 (GRCm39) missense possibly damaging 0.58
R1370:Dock10 UTSW 1 80,518,060 (GRCm39) missense probably damaging 1.00
R1440:Dock10 UTSW 1 80,526,853 (GRCm39) missense probably benign 0.03
R1469:Dock10 UTSW 1 80,490,275 (GRCm39) missense probably benign 0.05
R1469:Dock10 UTSW 1 80,490,275 (GRCm39) missense probably benign 0.05
R1525:Dock10 UTSW 1 80,583,881 (GRCm39) critical splice donor site probably null
R1544:Dock10 UTSW 1 80,570,352 (GRCm39) missense probably benign 0.00
R1601:Dock10 UTSW 1 80,527,519 (GRCm39) missense probably benign 0.00
R1757:Dock10 UTSW 1 80,511,586 (GRCm39) missense probably damaging 1.00
R1765:Dock10 UTSW 1 80,583,540 (GRCm39) missense probably damaging 1.00
R1783:Dock10 UTSW 1 80,551,897 (GRCm39) missense probably benign 0.17
R1823:Dock10 UTSW 1 80,520,814 (GRCm39) splice site probably null
R1827:Dock10 UTSW 1 80,508,009 (GRCm39) missense probably benign 0.07
R1844:Dock10 UTSW 1 80,520,918 (GRCm39) missense probably damaging 0.99
R1856:Dock10 UTSW 1 80,584,285 (GRCm39) missense possibly damaging 0.46
R1974:Dock10 UTSW 1 80,488,143 (GRCm39) missense possibly damaging 0.50
R2006:Dock10 UTSW 1 80,527,506 (GRCm39) missense possibly damaging 0.95
R2112:Dock10 UTSW 1 80,483,360 (GRCm39) missense probably damaging 0.99
R2112:Dock10 UTSW 1 80,483,359 (GRCm39) missense probably damaging 1.00
R2113:Dock10 UTSW 1 80,584,280 (GRCm39) missense probably damaging 1.00
R2439:Dock10 UTSW 1 80,510,149 (GRCm39) missense probably damaging 1.00
R2566:Dock10 UTSW 1 80,517,970 (GRCm39) missense possibly damaging 0.88
R3086:Dock10 UTSW 1 80,510,074 (GRCm39) missense possibly damaging 0.91
R3766:Dock10 UTSW 1 80,514,643 (GRCm39) missense probably damaging 0.99
R3768:Dock10 UTSW 1 80,510,085 (GRCm39) missense probably damaging 1.00
R4009:Dock10 UTSW 1 80,510,148 (GRCm39) missense probably damaging 1.00
R4016:Dock10 UTSW 1 80,584,286 (GRCm39) missense probably damaging 1.00
R4179:Dock10 UTSW 1 80,488,134 (GRCm39) missense probably benign 0.00
R4243:Dock10 UTSW 1 80,544,472 (GRCm39) missense probably benign 0.00
R4244:Dock10 UTSW 1 80,544,472 (GRCm39) missense probably benign 0.00
R4245:Dock10 UTSW 1 80,544,472 (GRCm39) missense probably benign 0.00
R4674:Dock10 UTSW 1 80,584,337 (GRCm39) missense possibly damaging 0.79
R4696:Dock10 UTSW 1 80,493,330 (GRCm39) missense possibly damaging 0.95
R4789:Dock10 UTSW 1 80,518,998 (GRCm39) missense probably damaging 1.00
R4851:Dock10 UTSW 1 80,526,874 (GRCm39) missense probably benign 0.33
R4911:Dock10 UTSW 1 80,583,953 (GRCm39) missense probably damaging 1.00
R4976:Dock10 UTSW 1 80,545,711 (GRCm39) critical splice donor site probably null
R5086:Dock10 UTSW 1 80,529,189 (GRCm39) missense possibly damaging 0.89
R5119:Dock10 UTSW 1 80,545,711 (GRCm39) critical splice donor site probably null
R5301:Dock10 UTSW 1 80,625,973 (GRCm39) missense probably benign 0.41
R5404:Dock10 UTSW 1 80,481,630 (GRCm39) intron probably benign
R5457:Dock10 UTSW 1 80,501,781 (GRCm39) missense probably damaging 1.00
R5790:Dock10 UTSW 1 80,482,887 (GRCm39) missense probably benign 0.00
R5845:Dock10 UTSW 1 80,483,459 (GRCm39) intron probably benign
R5871:Dock10 UTSW 1 80,519,057 (GRCm39) critical splice acceptor site probably null
R5873:Dock10 UTSW 1 80,551,855 (GRCm39) missense probably damaging 1.00
R5881:Dock10 UTSW 1 80,538,640 (GRCm39) missense probably benign 0.19
R5895:Dock10 UTSW 1 80,514,676 (GRCm39) missense probably benign
R5935:Dock10 UTSW 1 80,483,304 (GRCm39) intron probably benign
R5965:Dock10 UTSW 1 80,546,461 (GRCm39) splice site probably null
R5966:Dock10 UTSW 1 80,546,225 (GRCm39) missense possibly damaging 0.84
R6008:Dock10 UTSW 1 80,583,890 (GRCm39) missense probably damaging 0.98
R6029:Dock10 UTSW 1 80,514,663 (GRCm39) missense possibly damaging 0.68
R6083:Dock10 UTSW 1 80,510,148 (GRCm39) missense probably damaging 1.00
R6145:Dock10 UTSW 1 80,553,621 (GRCm39) nonsense probably null
R6257:Dock10 UTSW 1 80,481,413 (GRCm39) intron probably benign
R6274:Dock10 UTSW 1 80,516,540 (GRCm39) missense probably damaging 1.00
R6324:Dock10 UTSW 1 80,482,893 (GRCm39) missense probably benign 0.03
R6346:Dock10 UTSW 1 80,553,573 (GRCm39) splice site probably null
R6476:Dock10 UTSW 1 80,518,959 (GRCm39) nonsense probably null
R6516:Dock10 UTSW 1 80,518,178 (GRCm39) missense probably damaging 1.00
R6526:Dock10 UTSW 1 80,564,068 (GRCm39) missense probably damaging 0.97
R6534:Dock10 UTSW 1 80,481,388 (GRCm39) missense probably benign 0.01
R6620:Dock10 UTSW 1 80,570,355 (GRCm39) missense probably benign 0.01
R6640:Dock10 UTSW 1 80,511,555 (GRCm39) nonsense probably null
R6669:Dock10 UTSW 1 80,570,572 (GRCm39) missense probably damaging 1.00
R6672:Dock10 UTSW 1 80,490,248 (GRCm39) missense probably benign 0.00
R6679:Dock10 UTSW 1 80,544,514 (GRCm39) missense probably benign 0.11
R6682:Dock10 UTSW 1 80,490,338 (GRCm39) missense probably damaging 1.00
R6712:Dock10 UTSW 1 80,514,583 (GRCm39) missense probably benign 0.00
R6726:Dock10 UTSW 1 80,490,147 (GRCm39) missense probably damaging 1.00
R6788:Dock10 UTSW 1 80,508,962 (GRCm39) missense probably damaging 1.00
R6805:Dock10 UTSW 1 80,564,407 (GRCm39) missense probably benign
R6815:Dock10 UTSW 1 80,516,576 (GRCm39) missense possibly damaging 0.94
R6818:Dock10 UTSW 1 80,593,082 (GRCm39) missense possibly damaging 0.95
R6867:Dock10 UTSW 1 80,508,976 (GRCm39) missense probably damaging 1.00
R6964:Dock10 UTSW 1 80,481,365 (GRCm39) intron probably benign
R7026:Dock10 UTSW 1 80,479,504 (GRCm39) missense probably benign 0.40
R7084:Dock10 UTSW 1 80,481,573 (GRCm39) missense
R7087:Dock10 UTSW 1 80,570,543 (GRCm39) missense probably benign
R7158:Dock10 UTSW 1 80,564,589 (GRCm39) critical splice acceptor site probably null
R7191:Dock10 UTSW 1 80,518,048 (GRCm39) missense possibly damaging 0.93
R7214:Dock10 UTSW 1 80,546,246 (GRCm39) missense probably benign 0.01
R7255:Dock10 UTSW 1 80,520,816 (GRCm39) critical splice donor site probably null
R7320:Dock10 UTSW 1 80,527,421 (GRCm39) critical splice donor site probably null
R7359:Dock10 UTSW 1 80,687,065 (GRCm39) missense probably benign 0.01
R7423:Dock10 UTSW 1 80,501,497 (GRCm39) missense possibly damaging 0.67
R7464:Dock10 UTSW 1 80,518,032 (GRCm39) missense probably damaging 0.99
R7483:Dock10 UTSW 1 80,493,283 (GRCm39) missense probably benign 0.01
R7487:Dock10 UTSW 1 80,562,765 (GRCm39) missense probably benign 0.00
R7789:Dock10 UTSW 1 80,536,930 (GRCm39) missense possibly damaging 0.82
R7943:Dock10 UTSW 1 80,626,006 (GRCm39) missense probably damaging 0.98
R7962:Dock10 UTSW 1 80,564,085 (GRCm39) missense possibly damaging 0.88
R8079:Dock10 UTSW 1 80,556,421 (GRCm39) missense probably benign 0.00
R8086:Dock10 UTSW 1 80,481,707 (GRCm39) missense probably benign 0.17
R8184:Dock10 UTSW 1 80,530,469 (GRCm39) missense probably damaging 1.00
R8220:Dock10 UTSW 1 80,506,366 (GRCm39) missense probably null 1.00
R8225:Dock10 UTSW 1 80,481,447 (GRCm39) nonsense probably null
R8267:Dock10 UTSW 1 80,518,045 (GRCm39) missense probably benign 0.00
R8276:Dock10 UTSW 1 80,505,998 (GRCm39) missense probably benign
R8294:Dock10 UTSW 1 80,488,079 (GRCm39) missense possibly damaging 0.88
R8298:Dock10 UTSW 1 80,514,654 (GRCm39) missense probably benign 0.00
R8326:Dock10 UTSW 1 80,583,892 (GRCm39) missense possibly damaging 0.77
R8724:Dock10 UTSW 1 80,570,344 (GRCm39) missense probably benign 0.00
R8828:Dock10 UTSW 1 80,521,134 (GRCm39) missense probably damaging 1.00
R8846:Dock10 UTSW 1 80,545,786 (GRCm39) missense possibly damaging 0.93
R8919:Dock10 UTSW 1 80,483,147 (GRCm39) missense probably benign 0.00
R8950:Dock10 UTSW 1 80,519,016 (GRCm39) missense probably benign
R8993:Dock10 UTSW 1 80,551,888 (GRCm39) missense probably benign 0.21
R9028:Dock10 UTSW 1 80,584,012 (GRCm39) splice site probably benign
R9115:Dock10 UTSW 1 80,490,156 (GRCm39) missense probably damaging 1.00
R9327:Dock10 UTSW 1 80,510,184 (GRCm39) missense probably damaging 1.00
R9342:Dock10 UTSW 1 80,570,360 (GRCm39) missense probably benign
R9421:Dock10 UTSW 1 80,501,509 (GRCm39) missense probably damaging 1.00
R9431:Dock10 UTSW 1 80,583,593 (GRCm39) missense probably damaging 1.00
R9486:Dock10 UTSW 1 80,479,452 (GRCm39) missense unknown
R9521:Dock10 UTSW 1 80,501,763 (GRCm39) missense probably damaging 1.00
R9598:Dock10 UTSW 1 80,625,939 (GRCm39) missense probably benign 0.15
R9703:Dock10 UTSW 1 80,517,540 (GRCm39) missense probably damaging 0.98
RF021:Dock10 UTSW 1 80,542,290 (GRCm39) critical splice acceptor site probably null
X0025:Dock10 UTSW 1 80,514,637 (GRCm39) missense probably damaging 0.98
X0065:Dock10 UTSW 1 80,518,977 (GRCm39) missense probably damaging 1.00
Z1088:Dock10 UTSW 1 80,510,064 (GRCm39) missense probably damaging 1.00
Z1176:Dock10 UTSW 1 80,538,671 (GRCm39) missense probably benign
Z1177:Dock10 UTSW 1 80,536,917 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGAATAAGGACATTGGTGTAACCC -3'
(R):5'- GTACGTCTATCCTGTCCTGCAG -3'

Sequencing Primer
(F):5'- AGGACATTGGTGTAACCCTTCAG -3'
(R):5'- ACTAGCCCTGTGCCCCAG -3'
Posted On 2022-09-12