Incidental Mutation 'R0763:H2-Eb1'
ID72532
Institutional Source Beutler Lab
Gene Symbol H2-Eb1
Ensembl Gene ENSMUSG00000060586
Gene Namehistocompatibility 2, class II antigen E beta
SynonymsH-2Eb, Ia-4, Ia4
MMRRC Submission 038943-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0763 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34305877-34316199 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 34314159 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074557]
Predicted Effect probably benign
Transcript: ENSMUST00000074557
SMART Domains Protein: ENSMUSP00000074143
Gene: ENSMUSG00000060586

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MHC_II_beta 40 114 4.64e-47 SMART
IGc1 139 210 2.24e-24 SMART
transmembrane domain 226 248 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DRB5 belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DRA) and a beta (DRB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. DRB1 is expressed at a level five times higher than its paralogues DRB3, DRB4 and DRB5. The presence of DRB5 is linked with allelic variants of DRB1, otherwise it is omitted. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,838,279 F290V probably damaging Het
Adam26b G A 8: 43,520,564 S467L probably damaging Het
Adgrv1 T A 13: 81,499,125 I3099F probably damaging Het
Akap6 A G 12: 53,142,214 D2137G possibly damaging Het
Arhgdig T C 17: 26,200,301 Y48C probably damaging Het
Astn1 A G 1: 158,509,890 I389V possibly damaging Het
Atp8a1 T C 5: 67,659,883 D920G probably benign Het
BC016579 T A 16: 45,629,455 N200I probably damaging Het
Casc3 T C 11: 98,831,318 Y661H probably damaging Het
Cep120 A C 18: 53,721,737 V442G probably benign Het
Cfap65 A G 1: 74,904,682 Y1557H probably damaging Het
Chd2 G T 7: 73,447,274 Q1485K possibly damaging Het
Cntrl T C 2: 35,171,066 F1967L probably benign Het
Csmd1 G A 8: 17,027,284 T119M possibly damaging Het
Dnah9 T C 11: 66,155,530 H64R probably benign Het
Ep400 T C 5: 110,665,837 R2899G probably damaging Het
Fam205a1 A G 4: 42,851,238 V306A probably damaging Het
Foxl2 A C 9: 98,956,033 T125P probably damaging Het
Foxred1 A T 9: 35,207,473 probably null Het
Heatr3 T C 8: 88,158,241 S378P probably damaging Het
Hectd4 T C 5: 121,307,033 probably benign Het
Hps3 T G 3: 20,003,279 R780S probably damaging Het
Ifi44 G A 3: 151,749,498 A30V probably damaging Het
Il12rb1 G A 8: 70,813,290 probably benign Het
Invs G A 4: 48,392,628 G281R possibly damaging Het
Itgax C A 7: 128,147,940 probably benign Het
Jade1 G T 3: 41,613,783 C762F possibly damaging Het
Lama1 C T 17: 67,772,818 P1229S probably damaging Het
Mmp15 C A 8: 95,368,228 D243E probably benign Het
Mug2 A G 6: 122,075,294 T1004A probably benign Het
Myh14 A T 7: 44,665,367 V44E probably damaging Het
N4bp2l1 C A 5: 150,594,404 R11S possibly damaging Het
Notch4 T A 17: 34,565,332 C36* probably null Het
Nwd1 A G 8: 72,671,044 D637G probably damaging Het
Ogfod1 T C 8: 94,055,636 I238T probably benign Het
Palm2 G A 4: 57,688,441 E95K probably damaging Het
Papln A G 12: 83,791,865 D1256G possibly damaging Het
Ppp1r26 T C 2: 28,450,367 L3P probably damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc17a5 A T 9: 78,553,090 probably benign Het
Slc25a17 A G 15: 81,323,706 probably benign Het
Socs4 T C 14: 47,290,655 F349S probably damaging Het
Tchhl1 A C 3: 93,471,571 E527D probably benign Het
Tm7sf3 A G 6: 146,606,289 L425S possibly damaging Het
Tmem266 G T 9: 55,414,955 V112L probably damaging Het
Tmem30c T A 16: 57,270,176 I223F possibly damaging Het
Tomm70a G A 16: 57,122,172 G104D probably benign Het
Ttc17 G T 2: 94,332,803 A834E probably benign Het
Ttn C T 2: 76,731,190 V20664M probably damaging Het
Zbed5 T C 5: 129,902,179 V323A probably benign Het
Other mutations in H2-Eb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0724:H2-Eb1 UTSW 17 34315032 splice site probably benign
R2029:H2-Eb1 UTSW 17 34314392 missense probably damaging 1.00
R3155:H2-Eb1 UTSW 17 34314374 missense probably damaging 0.98
R3440:H2-Eb1 UTSW 17 34309681 missense probably damaging 1.00
R4050:H2-Eb1 UTSW 17 34314368 missense probably damaging 1.00
R4084:H2-Eb1 UTSW 17 34314443 missense probably damaging 0.98
R5605:H2-Eb1 UTSW 17 34309833 missense probably benign 0.09
R5667:H2-Eb1 UTSW 17 34314255 nonsense probably null
R5671:H2-Eb1 UTSW 17 34314255 nonsense probably null
R5851:H2-Eb1 UTSW 17 34309771 missense probably benign 0.13
R6951:H2-Eb1 UTSW 17 34309857 nonsense probably null
R7387:H2-Eb1 UTSW 17 34314233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTGATGTGACTGTGAATCCCTG -3'
(R):5'- GCCCGTGGACACAATTCCTGTTTTC -3'

Sequencing Primer
(F):5'- ATCCCTGTTTAGCCGACATGAAG -3'
(R):5'- GGACACAATTCCTGTTTTCTCCTC -3'
Posted On2013-09-30