Incidental Mutation 'R9629:Cox7a1'
ID 725341
Institutional Source Beutler Lab
Gene Symbol Cox7a1
Ensembl Gene ENSMUSG00000074218
Gene Name cytochrome c oxidase subunit 7A1
Synonyms COX7AM, COX7AH, COX7A, COX7AH
MMRRC Submission
Accession Numbers
Essential gene? Not available question?
Stock # R9629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 29883596-29885455 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29884583 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 30 (Q30R)
Ref Sequence ENSEMBL: ENSMUSP00000096193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001845] [ENSMUST00000085668] [ENSMUST00000098594] [ENSMUST00000108196] [ENSMUST00000126116] [ENSMUST00000208441]
AlphaFold P56392
Predicted Effect probably benign
Transcript: ENSMUST00000001845
SMART Domains Protein: ENSMUSP00000001845
Gene: ENSMUSG00000001794

DomainStartEndE-ValueType
low complexity region 10 64 N/A INTRINSIC
EFh 143 171 3.93e0 SMART
EFh 173 201 1.42e1 SMART
EFh 238 265 6.09e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085668
SMART Domains Protein: ENSMUSP00000082811
Gene: ENSMUSG00000066647

DomainStartEndE-ValueType
internal_repeat_1 50 74 2.89e-6 PROSPERO
internal_repeat_1 106 130 2.89e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000098594
AA Change: Q30R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096193
Gene: ENSMUSG00000074218
AA Change: Q30R

DomainStartEndE-ValueType
Pfam:COX7a 23 79 1.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108196
SMART Domains Protein: ENSMUSP00000103831
Gene: ENSMUSG00000001794

DomainStartEndE-ValueType
EFh 75 103 3.93e0 SMART
EFh 105 133 1.42e1 SMART
EFh 170 197 6.09e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126116
SMART Domains Protein: ENSMUSP00000117951
Gene: ENSMUSG00000001794

DomainStartEndE-ValueType
low complexity region 10 64 N/A INTRINSIC
EFh 143 171 3.93e0 SMART
EFh 173 201 1.42e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000208441
AA Change: Q39R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes polypeptide 1 (muscle isoform) of subunit VIIa and the polypeptide 1 is present only in muscle tissues. Other polypeptides of subunit VIIa are present in both muscle and nonmuscle tissues, and are encoded by different genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit some premature death and dilated cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,532,134 (GRCm39) E147G probably damaging Het
Agrn G A 4: 156,257,094 (GRCm39) Q1217* probably null Het
Ankrd13c G C 3: 157,653,313 (GRCm39) K50N probably benign Het
Anks3 C T 16: 4,775,565 (GRCm39) S144N probably damaging Het
Apob A T 12: 8,059,054 (GRCm39) D2512V probably damaging Het
Arhgap45 A G 10: 79,863,694 (GRCm39) K815E probably damaging Het
Atr T A 9: 95,747,098 (GRCm39) C127S probably benign Het
B4galnt4 A G 7: 140,648,575 (GRCm39) D697G probably damaging Het
C2cd3 C T 7: 100,029,249 (GRCm39) L134F probably damaging Het
Celsr2 C T 3: 108,308,915 (GRCm39) G1697D probably damaging Het
Cep170 A G 1: 176,583,821 (GRCm39) S88P possibly damaging Het
Cnot1 A G 8: 96,455,874 (GRCm39) V1961A probably damaging Het
Cntnap4 A G 8: 113,568,349 (GRCm39) N795S probably damaging Het
Cog2 T A 8: 125,260,125 (GRCm39) V256D possibly damaging Het
Col14a1 A G 15: 55,382,545 (GRCm39) Y515C Het
Cs T C 10: 128,196,885 (GRCm39) S427P probably damaging Het
Dbr1 T A 9: 99,464,523 (GRCm39) C101S Het
Dhcr7 C A 7: 143,401,212 (GRCm39) Y461* probably null Het
Dis3l2 T A 1: 86,974,784 (GRCm39) M691K probably benign Het
Dnah17 T C 11: 117,979,804 (GRCm39) D1751G probably damaging Het
Dock10 A T 1: 80,481,389 (GRCm39) I536K Het
Dok6 G T 18: 89,491,988 (GRCm39) F196L possibly damaging Het
Epx C T 11: 87,755,651 (GRCm39) D678N probably damaging Het
Fcrlb G C 1: 170,739,735 (GRCm39) P56A probably benign Het
Flrt3 T C 2: 140,502,816 (GRCm39) R271G possibly damaging Het
Galnt15 T A 14: 31,774,301 (GRCm39) L479Q probably damaging Het
Gfy G A 7: 44,827,785 (GRCm39) L104F probably benign Het
Gltp C T 5: 114,814,382 (GRCm39) M80I probably benign Het
Gm21560 G A 14: 6,218,250 (GRCm38) T76I probably benign Het
Gm5150 A G 3: 16,044,829 (GRCm39) I132T probably benign Het
Hdac9 T C 12: 34,439,389 (GRCm39) H437R probably damaging Het
Hpgd C A 8: 56,751,419 (GRCm39) F82L Het
Ifi207 GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT 1: 173,556,561 (GRCm39) probably benign Het
Ilrun A T 17: 28,012,913 (GRCm39) F95I probably damaging Het
Itgb5 C T 16: 33,696,295 (GRCm39) T162I probably damaging Het
Jakmip3 G A 7: 138,625,118 (GRCm39) probably null Het
Kctd1 A T 18: 15,196,611 (GRCm39) M4K unknown Het
Kirrel1 C A 3: 87,003,025 (GRCm39) E123* probably null Het
Krt87 G C 15: 101,389,048 (GRCm39) P95A probably benign Het
Man1a A T 10: 53,796,158 (GRCm39) H511Q probably damaging Het
Megf8 A G 7: 25,043,194 (GRCm39) D1372G possibly damaging Het
Mrgprd A G 7: 144,875,189 (GRCm39) D20G probably benign Het
Mrpl54 C T 10: 81,101,528 (GRCm39) G78S probably damaging Het
Myl1 T A 1: 66,969,448 (GRCm39) E61D probably benign Het
Myo7a G T 7: 97,712,937 (GRCm39) H1679Q probably benign Het
Naca A G 10: 127,878,226 (GRCm39) E1086G unknown Het
Nagpa C G 16: 5,017,829 (GRCm39) D258H probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nr2f6 G A 8: 71,827,171 (GRCm39) L377F probably damaging Het
Ntsr1 G A 2: 180,183,274 (GRCm39) R328H probably damaging Het
Nup93 G A 8: 95,033,267 (GRCm39) S592N probably damaging Het
Or10a2 A T 7: 106,673,164 (GRCm39) N43I probably damaging Het
Or4k40 T A 2: 111,251,137 (GRCm39) H53L probably benign Het
Or8g36 T C 9: 39,422,497 (GRCm39) D173G probably benign Het
Pard3 T C 8: 128,136,153 (GRCm39) V842A possibly damaging Het
Phospho2 T A 2: 69,626,295 (GRCm39) N150K probably damaging Het
Piwil1 T C 5: 128,831,051 (GRCm39) S791P probably damaging Het
Pkhd1 A G 1: 20,462,437 (GRCm39) V2039A possibly damaging Het
Ppp1r3c A G 19: 36,711,404 (GRCm39) I122T probably benign Het
Prrc2c A G 1: 162,519,959 (GRCm39) Y2131H possibly damaging Het
Qtrt2 T C 16: 43,683,540 (GRCm39) M311V possibly damaging Het
Rbbp4 T C 4: 129,212,243 (GRCm39) D346G probably damaging Het
Slc13a5 A G 11: 72,138,578 (GRCm39) I455T probably damaging Het
Slc28a3 A T 13: 58,717,187 (GRCm39) Y366* probably null Het
Srgap1 T A 10: 121,705,746 (GRCm39) Q226L probably benign Het
Syt17 A G 7: 118,007,379 (GRCm39) V362A probably damaging Het
Tas2r117 T C 6: 132,780,374 (GRCm39) S171P probably benign Het
Tfap2b A T 1: 19,289,468 (GRCm39) I198F probably damaging Het
Tg A T 15: 66,555,587 (GRCm39) I760F possibly damaging Het
Tmem123 T C 9: 7,790,984 (GRCm39) V95A possibly damaging Het
Tmem198b C A 10: 128,638,386 (GRCm39) G59V probably damaging Het
Tmem30c T G 16: 57,096,585 (GRCm39) I179L probably benign Het
Tmprss2 A T 16: 97,369,702 (GRCm39) D357E probably benign Het
Tns3 G A 11: 8,401,142 (GRCm39) T1052M possibly damaging Het
Trex1 A T 9: 108,887,632 (GRCm39) C120S probably damaging Het
Ttc8 A G 12: 98,886,965 (GRCm39) S13G possibly damaging Het
Ttll7 T C 3: 146,621,487 (GRCm39) I362T probably damaging Het
Usp34 A T 11: 23,314,364 (GRCm39) T769S Het
Vmn1r185 G T 7: 26,311,439 (GRCm39) T22K probably damaging Het
Vmn1r39 T G 6: 66,781,578 (GRCm39) M247L probably benign Het
Vmn2r96 A G 17: 18,803,257 (GRCm39) D389G probably benign Het
Xirp1 C T 9: 119,846,379 (GRCm39) V835I probably benign Het
Ylpm1 T G 12: 85,044,036 (GRCm39) I258S unknown Het
Zfp971 A T 2: 177,675,417 (GRCm39) S339C probably damaging Het
Other mutations in Cox7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02650:Cox7a1 APN 7 29,884,562 (GRCm39) missense possibly damaging 0.87
IGL03034:Cox7a1 APN 7 29,884,693 (GRCm39) splice site probably benign
Predicted Primers PCR Primer
(F):5'- TGTAGTCCCCACATCGCAAAG -3'
(R):5'- TCTTATGACCAGAGCAAGCCAG -3'

Sequencing Primer
(F):5'- GCAAAGCGCTCCCTTCCTG -3'
(R):5'- CATGGTCAGTCTGTACAGGAC -3'
Posted On 2022-09-12