Incidental Mutation 'R9629:Dhcr7'
ID 725349
Institutional Source Beutler Lab
Gene Symbol Dhcr7
Ensembl Gene ENSMUSG00000058454
Gene Name 7-dehydrocholesterol reductase
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 143376882-143402147 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 143401212 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 461 (Y461*)
Ref Sequence ENSEMBL: ENSMUSP00000146947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073878] [ENSMUST00000124340] [ENSMUST00000141916] [ENSMUST00000143338] [ENSMUST00000144034] [ENSMUST00000145471] [ENSMUST00000207143]
AlphaFold O88455
Predicted Effect probably null
Transcript: ENSMUST00000073878
AA Change: Y458*
SMART Domains Protein: ENSMUSP00000073541
Gene: ENSMUSG00000058454
AA Change: Y458*

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124340
AA Change: Y458*
SMART Domains Protein: ENSMUSP00000117659
Gene: ENSMUSG00000058454
AA Change: Y458*

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000141916
AA Change: Y458*
SMART Domains Protein: ENSMUSP00000121782
Gene: ENSMUSG00000058454
AA Change: Y458*

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143338
SMART Domains Protein: ENSMUSP00000119984
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144034
SMART Domains Protein: ENSMUSP00000118957
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:ERG4_ERG24 75 225 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145471
Predicted Effect probably null
Transcript: ENSMUST00000207143
AA Change: Y461*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that removes the C(7-8) double bond in the B ring of sterols and catalyzes the conversion of 7-dehydrocholesterol to cholesterol. This gene is ubiquitously expressed and its transmembrane protein localizes to the endoplasmic reticulum membrane and nuclear outer membrane. Mutations in this gene cause Smith-Lemli-Opitz syndrome (SLOS); a syndrome that is metabolically characterized by reduced serum cholesterol levels and elevated serum 7-dehydrocholesterol levels and phenotypically characterized by mental retardation, facial dysmorphism, syndactyly of second and third toes, and holoprosencephaly in severe cases to minimal physical abnormalities and near-normal intelligence in mild cases. Alternative splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene die within one day of birth due to respiratory and suckling problems. They exhibit abnormal cholesterol homeostasis with reduced tissue cholesterol levels and total sterol levels, enlarged bladders and sometimes cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,532,134 (GRCm39) E147G probably damaging Het
Agrn G A 4: 156,257,094 (GRCm39) Q1217* probably null Het
Ankrd13c G C 3: 157,653,313 (GRCm39) K50N probably benign Het
Anks3 C T 16: 4,775,565 (GRCm39) S144N probably damaging Het
Apob A T 12: 8,059,054 (GRCm39) D2512V probably damaging Het
Arhgap45 A G 10: 79,863,694 (GRCm39) K815E probably damaging Het
Atr T A 9: 95,747,098 (GRCm39) C127S probably benign Het
B4galnt4 A G 7: 140,648,575 (GRCm39) D697G probably damaging Het
C2cd3 C T 7: 100,029,249 (GRCm39) L134F probably damaging Het
Celsr2 C T 3: 108,308,915 (GRCm39) G1697D probably damaging Het
Cep170 A G 1: 176,583,821 (GRCm39) S88P possibly damaging Het
Cnot1 A G 8: 96,455,874 (GRCm39) V1961A probably damaging Het
Cntnap4 A G 8: 113,568,349 (GRCm39) N795S probably damaging Het
Cog2 T A 8: 125,260,125 (GRCm39) V256D possibly damaging Het
Col14a1 A G 15: 55,382,545 (GRCm39) Y515C Het
Cox7a1 A G 7: 29,884,583 (GRCm39) Q30R probably damaging Het
Cs T C 10: 128,196,885 (GRCm39) S427P probably damaging Het
Dbr1 T A 9: 99,464,523 (GRCm39) C101S Het
Dis3l2 T A 1: 86,974,784 (GRCm39) M691K probably benign Het
Dnah17 T C 11: 117,979,804 (GRCm39) D1751G probably damaging Het
Dock10 A T 1: 80,481,389 (GRCm39) I536K Het
Dok6 G T 18: 89,491,988 (GRCm39) F196L possibly damaging Het
Epx C T 11: 87,755,651 (GRCm39) D678N probably damaging Het
Fcrlb G C 1: 170,739,735 (GRCm39) P56A probably benign Het
Flrt3 T C 2: 140,502,816 (GRCm39) R271G possibly damaging Het
Galnt15 T A 14: 31,774,301 (GRCm39) L479Q probably damaging Het
Gfy G A 7: 44,827,785 (GRCm39) L104F probably benign Het
Gltp C T 5: 114,814,382 (GRCm39) M80I probably benign Het
Gm21560 G A 14: 6,218,250 (GRCm38) T76I probably benign Het
Gm5150 A G 3: 16,044,829 (GRCm39) I132T probably benign Het
Hdac9 T C 12: 34,439,389 (GRCm39) H437R probably damaging Het
Hpgd C A 8: 56,751,419 (GRCm39) F82L Het
Ifi207 GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT 1: 173,556,561 (GRCm39) probably benign Het
Ilrun A T 17: 28,012,913 (GRCm39) F95I probably damaging Het
Itgb5 C T 16: 33,696,295 (GRCm39) T162I probably damaging Het
Jakmip3 G A 7: 138,625,118 (GRCm39) probably null Het
Kctd1 A T 18: 15,196,611 (GRCm39) M4K unknown Het
Kirrel1 C A 3: 87,003,025 (GRCm39) E123* probably null Het
Krt87 G C 15: 101,389,048 (GRCm39) P95A probably benign Het
Man1a A T 10: 53,796,158 (GRCm39) H511Q probably damaging Het
Megf8 A G 7: 25,043,194 (GRCm39) D1372G possibly damaging Het
Mrgprd A G 7: 144,875,189 (GRCm39) D20G probably benign Het
Mrpl54 C T 10: 81,101,528 (GRCm39) G78S probably damaging Het
Myl1 T A 1: 66,969,448 (GRCm39) E61D probably benign Het
Myo7a G T 7: 97,712,937 (GRCm39) H1679Q probably benign Het
Naca A G 10: 127,878,226 (GRCm39) E1086G unknown Het
Nagpa C G 16: 5,017,829 (GRCm39) D258H probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nr2f6 G A 8: 71,827,171 (GRCm39) L377F probably damaging Het
Ntsr1 G A 2: 180,183,274 (GRCm39) R328H probably damaging Het
Nup93 G A 8: 95,033,267 (GRCm39) S592N probably damaging Het
Or10a2 A T 7: 106,673,164 (GRCm39) N43I probably damaging Het
Or4k40 T A 2: 111,251,137 (GRCm39) H53L probably benign Het
Or8g36 T C 9: 39,422,497 (GRCm39) D173G probably benign Het
Pard3 T C 8: 128,136,153 (GRCm39) V842A possibly damaging Het
Phospho2 T A 2: 69,626,295 (GRCm39) N150K probably damaging Het
Piwil1 T C 5: 128,831,051 (GRCm39) S791P probably damaging Het
Pkhd1 A G 1: 20,462,437 (GRCm39) V2039A possibly damaging Het
Ppp1r3c A G 19: 36,711,404 (GRCm39) I122T probably benign Het
Prrc2c A G 1: 162,519,959 (GRCm39) Y2131H possibly damaging Het
Qtrt2 T C 16: 43,683,540 (GRCm39) M311V possibly damaging Het
Rbbp4 T C 4: 129,212,243 (GRCm39) D346G probably damaging Het
Slc13a5 A G 11: 72,138,578 (GRCm39) I455T probably damaging Het
Slc28a3 A T 13: 58,717,187 (GRCm39) Y366* probably null Het
Srgap1 T A 10: 121,705,746 (GRCm39) Q226L probably benign Het
Syt17 A G 7: 118,007,379 (GRCm39) V362A probably damaging Het
Tas2r117 T C 6: 132,780,374 (GRCm39) S171P probably benign Het
Tfap2b A T 1: 19,289,468 (GRCm39) I198F probably damaging Het
Tg A T 15: 66,555,587 (GRCm39) I760F possibly damaging Het
Tmem123 T C 9: 7,790,984 (GRCm39) V95A possibly damaging Het
Tmem198b C A 10: 128,638,386 (GRCm39) G59V probably damaging Het
Tmem30c T G 16: 57,096,585 (GRCm39) I179L probably benign Het
Tmprss2 A T 16: 97,369,702 (GRCm39) D357E probably benign Het
Tns3 G A 11: 8,401,142 (GRCm39) T1052M possibly damaging Het
Trex1 A T 9: 108,887,632 (GRCm39) C120S probably damaging Het
Ttc8 A G 12: 98,886,965 (GRCm39) S13G possibly damaging Het
Ttll7 T C 3: 146,621,487 (GRCm39) I362T probably damaging Het
Usp34 A T 11: 23,314,364 (GRCm39) T769S Het
Vmn1r185 G T 7: 26,311,439 (GRCm39) T22K probably damaging Het
Vmn1r39 T G 6: 66,781,578 (GRCm39) M247L probably benign Het
Vmn2r96 A G 17: 18,803,257 (GRCm39) D389G probably benign Het
Xirp1 C T 9: 119,846,379 (GRCm39) V835I probably benign Het
Ylpm1 T G 12: 85,044,036 (GRCm39) I258S unknown Het
Zfp971 A T 2: 177,675,417 (GRCm39) S339C probably damaging Het
Other mutations in Dhcr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Dhcr7 APN 7 143,400,805 (GRCm39) missense probably damaging 0.99
IGL01398:Dhcr7 APN 7 143,395,056 (GRCm39) missense probably damaging 0.99
IGL01668:Dhcr7 APN 7 143,397,048 (GRCm39) missense probably damaging 1.00
IGL01822:Dhcr7 APN 7 143,399,236 (GRCm39) missense probably damaging 1.00
IGL02332:Dhcr7 APN 7 143,396,865 (GRCm39) missense probably damaging 1.00
IGL03136:Dhcr7 APN 7 143,401,103 (GRCm39) missense probably damaging 1.00
IGL03334:Dhcr7 APN 7 143,394,234 (GRCm39) missense possibly damaging 0.80
R0350:Dhcr7 UTSW 7 143,391,507 (GRCm39) missense probably damaging 1.00
R0433:Dhcr7 UTSW 7 143,394,200 (GRCm39) missense possibly damaging 0.92
R0834:Dhcr7 UTSW 7 143,394,964 (GRCm39) missense probably benign 0.19
R1473:Dhcr7 UTSW 7 143,400,805 (GRCm39) missense probably damaging 0.99
R1473:Dhcr7 UTSW 7 143,395,105 (GRCm39) missense probably damaging 1.00
R1769:Dhcr7 UTSW 7 143,401,250 (GRCm39) missense probably damaging 1.00
R1773:Dhcr7 UTSW 7 143,401,195 (GRCm39) missense possibly damaging 0.87
R1997:Dhcr7 UTSW 7 143,401,167 (GRCm39) missense probably damaging 0.99
R2302:Dhcr7 UTSW 7 143,391,629 (GRCm39) missense probably benign 0.00
R4177:Dhcr7 UTSW 7 143,394,910 (GRCm39) missense probably damaging 1.00
R4275:Dhcr7 UTSW 7 143,396,964 (GRCm39) missense probably damaging 1.00
R4829:Dhcr7 UTSW 7 143,391,654 (GRCm39) missense probably damaging 1.00
R4860:Dhcr7 UTSW 7 143,394,237 (GRCm39) missense probably benign 0.05
R4860:Dhcr7 UTSW 7 143,394,237 (GRCm39) missense probably benign 0.05
R4944:Dhcr7 UTSW 7 143,391,528 (GRCm39) missense probably damaging 0.96
R5000:Dhcr7 UTSW 7 143,395,060 (GRCm39) missense possibly damaging 0.94
R5454:Dhcr7 UTSW 7 143,391,576 (GRCm39) missense probably damaging 1.00
R5633:Dhcr7 UTSW 7 143,401,160 (GRCm39) missense probably damaging 0.99
R6337:Dhcr7 UTSW 7 143,390,468 (GRCm39) critical splice donor site probably null
R6683:Dhcr7 UTSW 7 143,397,048 (GRCm39) missense probably damaging 0.99
R7175:Dhcr7 UTSW 7 143,399,227 (GRCm39) missense probably damaging 1.00
R7785:Dhcr7 UTSW 7 143,399,209 (GRCm39) missense probably damaging 1.00
R8947:Dhcr7 UTSW 7 143,400,959 (GRCm39) missense probably damaging 1.00
R9006:Dhcr7 UTSW 7 143,394,978 (GRCm39) missense probably benign
R9052:Dhcr7 UTSW 7 143,395,060 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACTTCAACTATACTGGTGACCTG -3'
(R):5'- GAACAAGCCATTCTGCTGGG -3'

Sequencing Primer
(F):5'- CAACTATACTGGTGACCTGATGGGC -3'
(R):5'- ACAAGCCATTCTGCTGGGGTATC -3'
Posted On 2022-09-12