Incidental Mutation 'R9629:Hpgd'
ID 725351
Institutional Source Beutler Lab
Gene Symbol Hpgd
Ensembl Gene ENSMUSG00000031613
Gene Name hydroxyprostaglandin dehydrogenase 15 (NAD)
Synonyms 15-PGDH
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 56747620-56774078 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 56751419 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 82 (F82L)
Ref Sequence ENSEMBL: ENSMUSP00000034026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034026]
AlphaFold Q8VCC1
Predicted Effect
SMART Domains Protein: ENSMUSP00000034026
Gene: ENSMUSG00000031613
AA Change: F82L

DomainStartEndE-ValueType
Pfam:KR 6 175 6.6e-11 PFAM
Pfam:adh_short 6 199 1.7e-59 PFAM
Pfam:adh_short_C2 12 252 1.3e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain nonmetalloenzyme alcohol dehydrogenase protein family. The encoded enzyme is responsible for the metabolism of prostaglandins, which function in a variety of physiologic and cellular processes such as inflammation. Mutations in this gene result in primary autosomal recessive hypertrophic osteoarthropathy and cranioosteoarthropathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutation of this gene results failure of the ductus arteriosus to close and perinatal lethality. Mutant animals die within 12-48 hours after birth due to congestive heart failure. Mice homozygous for a hypomorphic allele exhibit preterm labor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,532,134 (GRCm39) E147G probably damaging Het
Agrn G A 4: 156,257,094 (GRCm39) Q1217* probably null Het
Ankrd13c G C 3: 157,653,313 (GRCm39) K50N probably benign Het
Anks3 C T 16: 4,775,565 (GRCm39) S144N probably damaging Het
Apob A T 12: 8,059,054 (GRCm39) D2512V probably damaging Het
Arhgap45 A G 10: 79,863,694 (GRCm39) K815E probably damaging Het
Atr T A 9: 95,747,098 (GRCm39) C127S probably benign Het
B4galnt4 A G 7: 140,648,575 (GRCm39) D697G probably damaging Het
C2cd3 C T 7: 100,029,249 (GRCm39) L134F probably damaging Het
Celsr2 C T 3: 108,308,915 (GRCm39) G1697D probably damaging Het
Cep170 A G 1: 176,583,821 (GRCm39) S88P possibly damaging Het
Cnot1 A G 8: 96,455,874 (GRCm39) V1961A probably damaging Het
Cntnap4 A G 8: 113,568,349 (GRCm39) N795S probably damaging Het
Cog2 T A 8: 125,260,125 (GRCm39) V256D possibly damaging Het
Col14a1 A G 15: 55,382,545 (GRCm39) Y515C Het
Cox7a1 A G 7: 29,884,583 (GRCm39) Q30R probably damaging Het
Cs T C 10: 128,196,885 (GRCm39) S427P probably damaging Het
Dbr1 T A 9: 99,464,523 (GRCm39) C101S Het
Dhcr7 C A 7: 143,401,212 (GRCm39) Y461* probably null Het
Dis3l2 T A 1: 86,974,784 (GRCm39) M691K probably benign Het
Dnah17 T C 11: 117,979,804 (GRCm39) D1751G probably damaging Het
Dock10 A T 1: 80,481,389 (GRCm39) I536K Het
Dok6 G T 18: 89,491,988 (GRCm39) F196L possibly damaging Het
Epx C T 11: 87,755,651 (GRCm39) D678N probably damaging Het
Fcrlb G C 1: 170,739,735 (GRCm39) P56A probably benign Het
Flrt3 T C 2: 140,502,816 (GRCm39) R271G possibly damaging Het
Galnt15 T A 14: 31,774,301 (GRCm39) L479Q probably damaging Het
Gfy G A 7: 44,827,785 (GRCm39) L104F probably benign Het
Gltp C T 5: 114,814,382 (GRCm39) M80I probably benign Het
Gm21560 G A 14: 6,218,250 (GRCm38) T76I probably benign Het
Gm5150 A G 3: 16,044,829 (GRCm39) I132T probably benign Het
Hdac9 T C 12: 34,439,389 (GRCm39) H437R probably damaging Het
Ifi207 GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT 1: 173,556,561 (GRCm39) probably benign Het
Ilrun A T 17: 28,012,913 (GRCm39) F95I probably damaging Het
Itgb5 C T 16: 33,696,295 (GRCm39) T162I probably damaging Het
Jakmip3 G A 7: 138,625,118 (GRCm39) probably null Het
Kctd1 A T 18: 15,196,611 (GRCm39) M4K unknown Het
Kirrel1 C A 3: 87,003,025 (GRCm39) E123* probably null Het
Krt87 G C 15: 101,389,048 (GRCm39) P95A probably benign Het
Man1a A T 10: 53,796,158 (GRCm39) H511Q probably damaging Het
Megf8 A G 7: 25,043,194 (GRCm39) D1372G possibly damaging Het
Mrgprd A G 7: 144,875,189 (GRCm39) D20G probably benign Het
Mrpl54 C T 10: 81,101,528 (GRCm39) G78S probably damaging Het
Myl1 T A 1: 66,969,448 (GRCm39) E61D probably benign Het
Myo7a G T 7: 97,712,937 (GRCm39) H1679Q probably benign Het
Naca A G 10: 127,878,226 (GRCm39) E1086G unknown Het
Nagpa C G 16: 5,017,829 (GRCm39) D258H probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nr2f6 G A 8: 71,827,171 (GRCm39) L377F probably damaging Het
Ntsr1 G A 2: 180,183,274 (GRCm39) R328H probably damaging Het
Nup93 G A 8: 95,033,267 (GRCm39) S592N probably damaging Het
Or10a2 A T 7: 106,673,164 (GRCm39) N43I probably damaging Het
Or4k40 T A 2: 111,251,137 (GRCm39) H53L probably benign Het
Or8g36 T C 9: 39,422,497 (GRCm39) D173G probably benign Het
Pard3 T C 8: 128,136,153 (GRCm39) V842A possibly damaging Het
Phospho2 T A 2: 69,626,295 (GRCm39) N150K probably damaging Het
Piwil1 T C 5: 128,831,051 (GRCm39) S791P probably damaging Het
Pkhd1 A G 1: 20,462,437 (GRCm39) V2039A possibly damaging Het
Ppp1r3c A G 19: 36,711,404 (GRCm39) I122T probably benign Het
Prrc2c A G 1: 162,519,959 (GRCm39) Y2131H possibly damaging Het
Qtrt2 T C 16: 43,683,540 (GRCm39) M311V possibly damaging Het
Rbbp4 T C 4: 129,212,243 (GRCm39) D346G probably damaging Het
Slc13a5 A G 11: 72,138,578 (GRCm39) I455T probably damaging Het
Slc28a3 A T 13: 58,717,187 (GRCm39) Y366* probably null Het
Srgap1 T A 10: 121,705,746 (GRCm39) Q226L probably benign Het
Syt17 A G 7: 118,007,379 (GRCm39) V362A probably damaging Het
Tas2r117 T C 6: 132,780,374 (GRCm39) S171P probably benign Het
Tfap2b A T 1: 19,289,468 (GRCm39) I198F probably damaging Het
Tg A T 15: 66,555,587 (GRCm39) I760F possibly damaging Het
Tmem123 T C 9: 7,790,984 (GRCm39) V95A possibly damaging Het
Tmem198b C A 10: 128,638,386 (GRCm39) G59V probably damaging Het
Tmem30c T G 16: 57,096,585 (GRCm39) I179L probably benign Het
Tmprss2 A T 16: 97,369,702 (GRCm39) D357E probably benign Het
Tns3 G A 11: 8,401,142 (GRCm39) T1052M possibly damaging Het
Trex1 A T 9: 108,887,632 (GRCm39) C120S probably damaging Het
Ttc8 A G 12: 98,886,965 (GRCm39) S13G possibly damaging Het
Ttll7 T C 3: 146,621,487 (GRCm39) I362T probably damaging Het
Usp34 A T 11: 23,314,364 (GRCm39) T769S Het
Vmn1r185 G T 7: 26,311,439 (GRCm39) T22K probably damaging Het
Vmn1r39 T G 6: 66,781,578 (GRCm39) M247L probably benign Het
Vmn2r96 A G 17: 18,803,257 (GRCm39) D389G probably benign Het
Xirp1 C T 9: 119,846,379 (GRCm39) V835I probably benign Het
Ylpm1 T G 12: 85,044,036 (GRCm39) I258S unknown Het
Zfp971 A T 2: 177,675,417 (GRCm39) S339C probably damaging Het
Other mutations in Hpgd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01993:Hpgd APN 8 56,772,097 (GRCm39) missense probably benign 0.04
R0703:Hpgd UTSW 8 56,748,074 (GRCm39) missense probably damaging 1.00
R0705:Hpgd UTSW 8 56,748,074 (GRCm39) missense probably damaging 1.00
R1138:Hpgd UTSW 8 56,760,712 (GRCm39) missense probably benign 0.00
R2081:Hpgd UTSW 8 56,760,677 (GRCm39) missense probably benign
R3177:Hpgd UTSW 8 56,751,448 (GRCm39) missense probably damaging 1.00
R3277:Hpgd UTSW 8 56,751,448 (GRCm39) missense probably damaging 1.00
R3782:Hpgd UTSW 8 56,751,453 (GRCm39) missense probably damaging 1.00
R4774:Hpgd UTSW 8 56,751,454 (GRCm39) missense probably damaging 1.00
R4874:Hpgd UTSW 8 56,770,838 (GRCm39) missense possibly damaging 0.78
R5501:Hpgd UTSW 8 56,751,391 (GRCm39) missense probably benign 0.04
R5828:Hpgd UTSW 8 56,772,106 (GRCm39) missense probably benign 0.10
R5846:Hpgd UTSW 8 56,760,702 (GRCm39) missense possibly damaging 0.90
R6136:Hpgd UTSW 8 56,747,987 (GRCm39) missense probably damaging 1.00
R7252:Hpgd UTSW 8 56,751,461 (GRCm39) missense probably damaging 1.00
R8841:Hpgd UTSW 8 56,760,709 (GRCm39) missense probably damaging 1.00
R9659:Hpgd UTSW 8 56,772,075 (GRCm39) missense probably damaging 1.00
R9731:Hpgd UTSW 8 56,751,391 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCTCTTTGATTAGAAGACGCAAC -3'
(R):5'- AAATGCACTGAACTCTGCTTCTC -3'

Sequencing Primer
(F):5'- GCAACCTAAATTCAACCTCTAGTG -3'
(R):5'- TCTCTAACCCTTTAAGAGAGATTCTC -3'
Posted On 2022-09-12