Incidental Mutation 'R0764:Tram1'
ID72537
Institutional Source Beutler Lab
Gene Symbol Tram1
Ensembl Gene ENSMUSG00000025935
Gene Nametranslocating chain-associating membrane protein 1
SynonymsTRAMP, 1810049E02Rik
MMRRC Submission 038944-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R0764 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location13564698-13589910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13579709 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 97 (I97T)
Ref Sequence ENSEMBL: ENSMUSP00000027068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027068] [ENSMUST00000188377]
Predicted Effect probably damaging
Transcript: ENSMUST00000027068
AA Change: I97T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027068
Gene: ENSMUSG00000025935
AA Change: I97T

DomainStartEndE-ValueType
Pfam:TRAM1 47 115 6.1e-24 PFAM
TLC 117 326 2.36e-54 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185447
Predicted Effect probably benign
Transcript: ENSMUST00000188377
SMART Domains Protein: ENSMUSP00000140499
Gene: ENSMUSG00000025935

DomainStartEndE-ValueType
Blast:TLC 9 58 5e-24 BLAST
Meta Mutation Damage Score 0.2533 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes a multi-pass transmembrane protein of the endoplasmic reticulum (ER). It is involved in the process of cotranslational translocation of secretory proteins into the ER. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Acp4 T C 7: 44,252,314 probably benign Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cbl A T 9: 44,164,152 C399S probably damaging Het
Cdkl2 C A 5: 92,020,277 V353L probably benign Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Cep162 A G 9: 87,201,745 S1242P probably damaging Het
Crhr1 C T 11: 104,159,326 R66W probably damaging Het
Ddx49 T C 8: 70,297,257 E170G probably benign Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Ina T A 19: 47,023,648 *502K probably null Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Olfr170 G T 16: 19,606,432 P79T probably damaging Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Pcgf1 T C 6: 83,079,169 C2R probably damaging Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Plod3 C T 5: 136,989,583 probably benign Het
Purb C T 11: 6,475,661 V76M probably damaging Het
Ranbp1 C A 16: 18,240,158 E181* probably null Het
Rit2 T C 18: 31,153,701 probably benign Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc22a13 T C 9: 119,208,680 probably null Het
Slc35f4 T A 14: 49,306,339 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Ttc38 T C 15: 85,846,403 probably benign Het
Zfp113 T A 5: 138,145,244 Q248L probably damaging Het
Other mutations in Tram1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Tram1 APN 1 13579449 critical splice donor site probably null
IGL03071:Tram1 APN 1 13579774 nonsense probably null
IGL03123:Tram1 APN 1 13589605 missense probably benign 0.01
R1229:Tram1 UTSW 1 13569552 missense probably damaging 0.98
R1775:Tram1 UTSW 1 13576456 unclassified probably benign
R3877:Tram1 UTSW 1 13569603 missense probably benign 0.01
R4077:Tram1 UTSW 1 13566375 missense probably benign
R4747:Tram1 UTSW 1 13589646 missense probably damaging 1.00
R5197:Tram1 UTSW 1 13571902 missense probably benign 0.19
R5213:Tram1 UTSW 1 13579742 missense probably damaging 1.00
R5224:Tram1 UTSW 1 13578125 missense probably benign 0.10
R7362:Tram1 UTSW 1 13589608 missense probably benign 0.04
R7587:Tram1 UTSW 1 13579547 missense probably damaging 0.99
R7671:Tram1 UTSW 1 13589644 missense probably damaging 0.96
RF015:Tram1 UTSW 1 13579742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGAATGCACTGAGCTGACCAGAC -3'
(R):5'- GGTTGTCATTTCCCTTTGACCCGAG -3'

Sequencing Primer
(F):5'- GCTGACCAGACTCGTTAAACTTG -3'
(R):5'- CATAACTATGTTGTACCGAGTGCTG -3'
Posted On2013-09-30