Incidental Mutation 'R9629:Usp34'
ID 725373
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.624) question?
Stock # R9629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 23306895-23490560 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23364364 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 769 (T769S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180046]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: T769S

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180046
AA Change: T750S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: T750S

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,810,177 E147G probably damaging Het
Agrn G A 4: 156,172,637 Q1217* probably null Het
Ankrd13c G C 3: 157,947,676 K50N probably benign Het
Anks3 C T 16: 4,957,701 S144N probably damaging Het
Apob A T 12: 8,009,054 D2512V probably damaging Het
Arhgap45 A G 10: 80,027,860 K815E probably damaging Het
Atr T A 9: 95,865,045 C127S probably benign Het
B4galnt4 A G 7: 141,068,662 D697G probably damaging Het
C2cd3 C T 7: 100,380,042 L134F probably damaging Het
Celsr2 C T 3: 108,401,599 G1697D probably damaging Het
Cep170 A G 1: 176,756,255 S88P possibly damaging Het
Cnot1 A G 8: 95,729,246 V1961A probably damaging Het
Cntnap4 A G 8: 112,841,717 N795S probably damaging Het
Cog2 T A 8: 124,533,386 V256D possibly damaging Het
Col14a1 A G 15: 55,519,149 Y515C Het
Cox7a1 A G 7: 30,185,158 Q30R probably damaging Het
Cs T C 10: 128,361,016 S427P probably damaging Het
D17Wsu92e A T 17: 27,793,939 F95I probably damaging Het
Dbr1 T A 9: 99,582,470 C101S Het
Dhcr7 C A 7: 143,847,475 Y461* probably null Het
Dis3l2 T A 1: 87,047,062 M691K probably benign Het
Dnah17 T C 11: 118,088,978 D1751G probably damaging Het
Dock10 A T 1: 80,503,672 I536K Het
Dok6 G T 18: 89,473,864 F196L possibly damaging Het
Epx C T 11: 87,864,825 D678N probably damaging Het
Fcrlb G C 1: 170,912,166 P56A probably benign Het
Flrt3 T C 2: 140,660,896 R271G possibly damaging Het
Galnt15 T A 14: 32,052,344 L479Q probably damaging Het
Gfy G A 7: 45,178,361 L104F probably benign Het
Gltp C T 5: 114,676,321 M80I probably benign Het
Gm21560 G A 14: 6,218,250 T76I probably benign Het
Gm5150 A G 3: 15,990,665 I132T probably benign Het
Hdac9 T C 12: 34,389,390 H437R probably damaging Het
Hpgd C A 8: 56,298,384 F82L Het
Ifi207 GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT 1: 173,728,995 probably benign Het
Itgb5 C T 16: 33,875,925 T162I probably damaging Het
Jakmip3 G A 7: 139,023,389 probably null Het
Kctd1 A T 18: 15,063,554 M4K unknown Het
Kirrel C A 3: 87,095,718 E123* probably null Het
Krt83 G C 15: 101,491,167 P95A probably benign Het
Man1a A T 10: 53,920,062 H511Q probably damaging Het
Megf8 A G 7: 25,343,769 D1372G possibly damaging Het
Mrgprd A G 7: 145,321,452 D20G probably benign Het
Mrpl54 C T 10: 81,265,694 G78S probably damaging Het
Myl1 T A 1: 66,930,289 E61D probably benign Het
Myo7a G T 7: 98,063,730 H1679Q probably benign Het
Naca A G 10: 128,042,357 E1086G unknown Het
Nagpa C G 16: 5,199,965 D258H probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nr2f6 G A 8: 71,374,527 L377F probably damaging Het
Ntsr1 G A 2: 180,541,481 R328H probably damaging Het
Nup93 G A 8: 94,306,639 S592N probably damaging Het
Olfr1286 T A 2: 111,420,792 H53L probably benign Het
Olfr714 A T 7: 107,073,957 N43I probably damaging Het
Olfr957 T C 9: 39,511,201 D173G probably benign Het
Pard3 T C 8: 127,409,672 V842A possibly damaging Het
Phospho2 T A 2: 69,795,951 N150K probably damaging Het
Piwil1 T C 5: 128,753,987 S791P probably damaging Het
Pkhd1 A G 1: 20,392,213 V2039A possibly damaging Het
Ppp1r3c A G 19: 36,734,004 I122T probably benign Het
Prrc2c A G 1: 162,692,390 Y2131H possibly damaging Het
Qtrt2 T C 16: 43,863,177 M311V possibly damaging Het
Rbbp4 T C 4: 129,318,450 D346G probably damaging Het
Slc13a5 A G 11: 72,247,752 I455T probably damaging Het
Slc28a3 A T 13: 58,569,373 Y366* probably null Het
Srgap1 T A 10: 121,869,841 Q226L probably benign Het
Syt17 A G 7: 118,408,156 V362A probably damaging Het
Tas2r117 T C 6: 132,803,411 S171P probably benign Het
Tfap2b A T 1: 19,219,244 I198F probably damaging Het
Tg A T 15: 66,683,738 I760F possibly damaging Het
Tmem123 T C 9: 7,790,983 V95A possibly damaging Het
Tmem198b C A 10: 128,802,517 G59V probably damaging Het
Tmem30c T G 16: 57,276,222 I179L probably benign Het
Tmprss2 A T 16: 97,568,502 D357E probably benign Het
Tns3 G A 11: 8,451,142 T1052M possibly damaging Het
Trex1 A T 9: 109,058,564 C120S probably damaging Het
Ttc8 A G 12: 98,920,706 S13G possibly damaging Het
Ttll7 T C 3: 146,915,732 I362T probably damaging Het
Vmn1r185 G T 7: 26,612,014 T22K probably damaging Het
Vmn1r39 T G 6: 66,804,594 M247L probably benign Het
Vmn2r96 A G 17: 18,582,995 D389G probably benign Het
Xirp1 C T 9: 120,017,313 V835I probably benign Het
Ylpm1 T G 12: 84,997,262 I258S unknown Het
Zfp971 A T 2: 178,033,624 S339C probably damaging Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL00477:Usp34 APN 11 23468879 missense probably damaging 0.99
IGL01307:Usp34 APN 11 23417676 missense probably damaging 0.99
IGL01313:Usp34 APN 11 23473206 missense probably damaging 1.00
IGL01794:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01826:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01827:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01830:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01867:Usp34 APN 11 23384411 missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23345141 splice site probably benign
IGL01977:Usp34 APN 11 23452661 missense probably damaging 1.00
IGL01985:Usp34 APN 11 23452565 missense probably damaging 1.00
IGL02011:Usp34 APN 11 23471554 missense probably damaging 0.99
IGL02302:Usp34 APN 11 23467243 missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23354900 missense probably benign 0.11
IGL02491:Usp34 APN 11 23432630 missense probably damaging 0.98
IGL02532:Usp34 APN 11 23370291 missense probably damaging 0.99
IGL02561:Usp34 APN 11 23351652 missense probably benign 0.09
IGL02706:Usp34 APN 11 23388659 splice site probably benign
IGL02891:Usp34 APN 11 23487166 missense probably benign 0.09
IGL03079:Usp34 APN 11 23432247 missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23446958 missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23488686 missense probably benign
IGL03256:Usp34 APN 11 23420090 nonsense probably null
IGL03280:Usp34 APN 11 23354897 missense probably damaging 1.00
IGL03289:Usp34 APN 11 23393818 missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23446957 missense possibly damaging 0.92
Chub UTSW 11 23464686 missense probably damaging 0.99
Cicione UTSW 11 23489033 missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23457975 missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23343515 missense possibly damaging 0.94
Roebuck UTSW 11 23486810 splice site probably benign
stoat UTSW 11 23487203 missense
tunnelvision UTSW 11 23446968 missense
I2288:Usp34 UTSW 11 23432473 splice site probably benign
R0047:Usp34 UTSW 11 23464403 missense probably benign 0.34
R0047:Usp34 UTSW 11 23464403 missense probably benign 0.34
R0099:Usp34 UTSW 11 23363111 missense probably damaging 1.00
R0240:Usp34 UTSW 11 23433206 missense probably damaging 0.99
R0240:Usp34 UTSW 11 23433206 missense probably damaging 0.99
R0403:Usp34 UTSW 11 23333838 missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23401505 missense probably damaging 0.99
R0446:Usp34 UTSW 11 23467207 missense probably damaging 0.97
R0455:Usp34 UTSW 11 23446741 splice site probably benign
R0470:Usp34 UTSW 11 23436001 missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23384509 splice site probably benign
R0512:Usp34 UTSW 11 23451997 missense probably benign 0.04
R0557:Usp34 UTSW 11 23403848 missense probably damaging 0.98
R0562:Usp34 UTSW 11 23432406 splice site probably benign
R0656:Usp34 UTSW 11 23472967 missense probably damaging 0.99
R0693:Usp34 UTSW 11 23452637 missense probably damaging 0.97
R0739:Usp34 UTSW 11 23467243 missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23384420 missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23433175 splice site probably benign
R1223:Usp34 UTSW 11 23446464 splice site probably null
R1295:Usp34 UTSW 11 23384477 missense probably damaging 1.00
R1430:Usp34 UTSW 11 23459151 missense probably damaging 0.97
R1445:Usp34 UTSW 11 23351629 missense probably damaging 0.99
R1468:Usp34 UTSW 11 23441171 missense probably damaging 1.00
R1468:Usp34 UTSW 11 23441171 missense probably damaging 1.00
R1471:Usp34 UTSW 11 23488862 missense probably benign 0.20
R1475:Usp34 UTSW 11 23473253 missense probably damaging 0.99
R1628:Usp34 UTSW 11 23488725 missense probably damaging 1.00
R1631:Usp34 UTSW 11 23460651 missense probably damaging 0.99
R1655:Usp34 UTSW 11 23375051 missense probably benign 0.05
R1741:Usp34 UTSW 11 23364103 missense probably benign 0.00
R1854:Usp34 UTSW 11 23426153 missense probably benign 0.24
R1867:Usp34 UTSW 11 23361593 missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1870:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1871:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1967:Usp34 UTSW 11 23364503 missense probably benign 0.01
R2051:Usp34 UTSW 11 23464468 missense probably damaging 0.97
R2132:Usp34 UTSW 11 23464556 missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23382602 missense probably damaging 0.98
R2205:Usp34 UTSW 11 23385147 missense probably damaging 0.97
R2342:Usp34 UTSW 11 23403599 missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23370466 missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23464517 missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23343640 missense probably benign 0.28
R3972:Usp34 UTSW 11 23457803 missense probably damaging 1.00
R4018:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23417676 missense probably damaging 0.99
R4197:Usp34 UTSW 11 23444189 missense probably damaging 0.98
R4352:Usp34 UTSW 11 23320727 missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23384499 missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23435998 missense probably damaging 0.98
R4475:Usp34 UTSW 11 23457975 missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23401529 missense probably damaging 1.00
R4527:Usp34 UTSW 11 23421257 missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23464633 missense probably damaging 0.97
R4612:Usp34 UTSW 11 23432268 missense probably damaging 0.99
R4673:Usp34 UTSW 11 23364480 small deletion probably benign
R4707:Usp34 UTSW 11 23487215 missense probably damaging 1.00
R4736:Usp34 UTSW 11 23393749 splice site probably null
R4867:Usp34 UTSW 11 23451999 missense probably benign 0.28
R4879:Usp34 UTSW 11 23373410 missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23488982 missense probably damaging 1.00
R5004:Usp34 UTSW 11 23464586 missense probably damaging 1.00
R5057:Usp34 UTSW 11 23458086 intron probably benign
R5068:Usp34 UTSW 11 23460665 missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23343616 missense probably damaging 1.00
R5320:Usp34 UTSW 11 23333739 missense probably benign
R5327:Usp34 UTSW 11 23468846 missense probably damaging 1.00
R5328:Usp34 UTSW 11 23464616 missense probably benign 0.01
R5328:Usp34 UTSW 11 23488659 missense probably benign 0.04
R5390:Usp34 UTSW 11 23444202 critical splice donor site probably null
R5434:Usp34 UTSW 11 23412271 missense probably damaging 0.99
R5523:Usp34 UTSW 11 23349198 missense probably benign 0.39
R5567:Usp34 UTSW 11 23488336 missense probably damaging 0.97
R5571:Usp34 UTSW 11 23457975 missense probably damaging 0.99
R5645:Usp34 UTSW 11 23375024 missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23343515 missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23354846 missense probably benign 0.00
R5813:Usp34 UTSW 11 23421340 missense probably benign 0.38
R5921:Usp34 UTSW 11 23464686 missense probably damaging 0.99
R5928:Usp34 UTSW 11 23436040 missense probably damaging 0.98
R5944:Usp34 UTSW 11 23363089 missense probably damaging 1.00
R6198:Usp34 UTSW 11 23484127 missense probably damaging 1.00
R6229:Usp34 UTSW 11 23446778 missense probably damaging 0.99
R6306:Usp34 UTSW 11 23412260 missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23452520 missense probably damaging 0.98
R6341:Usp34 UTSW 11 23381353 missense probably damaging 0.97
R6374:Usp34 UTSW 11 23438914 missense probably damaging 1.00
R6398:Usp34 UTSW 11 23488666 missense probably benign
R6438:Usp34 UTSW 11 23364266 missense probably benign 0.02
R6668:Usp34 UTSW 11 23460659 missense probably damaging 0.97
R6700:Usp34 UTSW 11 23439011 missense probably damaging 1.00
R6783:Usp34 UTSW 11 23412318 missense probably damaging 1.00
R6821:Usp34 UTSW 11 23367491 missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23452569 missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23458023 missense probably damaging 0.98
R7020:Usp34 UTSW 11 23393954 missense probably benign 0.05
R7026:Usp34 UTSW 11 23361622 missense probably damaging 1.00
R7085:Usp34 UTSW 11 23363097 missense
R7101:Usp34 UTSW 11 23426183 missense
R7168:Usp34 UTSW 11 23464585 missense
R7192:Usp34 UTSW 11 23460571 missense
R7264:Usp34 UTSW 11 23333566 missense probably benign 0.00
R7325:Usp34 UTSW 11 23419052 missense
R7343:Usp34 UTSW 11 23488868 missense
R7358:Usp34 UTSW 11 23361683 missense probably damaging 0.99
R7369:Usp34 UTSW 11 23432361 missense
R7389:Usp34 UTSW 11 23345200 missense
R7459:Usp34 UTSW 11 23364458 missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23446968 missense
R7729:Usp34 UTSW 11 23449268 missense
R7777:Usp34 UTSW 11 23382638 missense
R7810:Usp34 UTSW 11 23412314 missense
R7836:Usp34 UTSW 11 23446614 missense
R7862:Usp34 UTSW 11 23464718 missense
R7993:Usp34 UTSW 11 23377622 missense
R8050:Usp34 UTSW 11 23446787 missense
R8054:Usp34 UTSW 11 23361295 missense
R8239:Usp34 UTSW 11 23446750 missense
R8266:Usp34 UTSW 11 23486810 splice site probably benign
R8347:Usp34 UTSW 11 23412345 missense
R8409:Usp34 UTSW 11 23457811 missense
R8692:Usp34 UTSW 11 23429325 missense
R8694:Usp34 UTSW 11 23484161 missense
R8734:Usp34 UTSW 11 23444184 missense
R8806:Usp34 UTSW 11 23484143 missense
R8914:Usp34 UTSW 11 23343604 missense
R8987:Usp34 UTSW 11 23464267 missense
R9013:Usp34 UTSW 11 23370302 missense
R9108:Usp34 UTSW 11 23370528 missense
R9264:Usp34 UTSW 11 23489064 missense
R9301:Usp34 UTSW 11 23472951 missense
R9375:Usp34 UTSW 11 23487203 missense
R9385:Usp34 UTSW 11 23449223 missense
R9500:Usp34 UTSW 11 23381337 missense probably damaging 0.99
R9566:Usp34 UTSW 11 23367529 missense
R9679:Usp34 UTSW 11 23444369 missense
R9680:Usp34 UTSW 11 23367385 missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23474351 missense
R9752:Usp34 UTSW 11 23459182 missense probably benign 0.11
X0023:Usp34 UTSW 11 23375028 missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23457824 missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23473221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAGGCACATCTGAAAGG -3'
(R):5'- CTAGCAACAATCATAGTCTTAGCC -3'

Sequencing Primer
(F):5'- CCAAGGCACATCTGAAAGGAATGG -3'
(R):5'- TGCAAACTAAGCATTTATTCTTAAGC -3'
Posted On 2022-09-12